Incidental Mutation 'R4516:Oas1d'
ID332909
Institutional Source Beutler Lab
Gene Symbol Oas1d
Ensembl Gene ENSMUSG00000032623
Gene Name2'-5' oligoadenylate synthetase 1D
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120914536-120921652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120919170 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 280 (T280S)
Ref Sequence ENSEMBL: ENSMUSP00000048054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044224]
Predicted Effect probably damaging
Transcript: ENSMUST00000044224
AA Change: T280S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048054
Gene: ENSMUSG00000032623
AA Change: T280S

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:OAS1_C 168 353 9.4e-76 PFAM
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype PHENOTYPE: Homozygous null females exhibit reduced fertility due to defects in ovarian follicle development and decreased efficiency of ovulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Oas1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Oas1d APN 5 120919207 missense possibly damaging 0.90
IGL01062:Oas1d APN 5 120919064 nonsense probably null
IGL01114:Oas1d APN 5 120916844 missense probably benign 0.08
IGL02336:Oas1d APN 5 120919048 missense probably damaging 1.00
IGL02444:Oas1d APN 5 120920008 missense probably benign 0.25
R0080:Oas1d UTSW 5 120916892 missense possibly damaging 0.61
R0388:Oas1d UTSW 5 120917028 missense probably damaging 1.00
R0674:Oas1d UTSW 5 120919986 missense probably benign
R1344:Oas1d UTSW 5 120914896 missense probably damaging 1.00
R1719:Oas1d UTSW 5 120919962 missense possibly damaging 0.79
R1771:Oas1d UTSW 5 120915837 missense probably damaging 0.98
R3810:Oas1d UTSW 5 120914986 missense probably damaging 1.00
R4559:Oas1d UTSW 5 120916895 missense probably benign 0.00
R4819:Oas1d UTSW 5 120915717 missense probably damaging 1.00
R4926:Oas1d UTSW 5 120915768 missense probably benign
R5199:Oas1d UTSW 5 120919145 missense probably benign 0.03
R5392:Oas1d UTSW 5 120916940 missense possibly damaging 0.95
R5695:Oas1d UTSW 5 120915011 missense probably benign
R5769:Oas1d UTSW 5 120916854 missense probably benign 0.00
R6259:Oas1d UTSW 5 120919181 nonsense probably null
R7276:Oas1d UTSW 5 120916881 missense possibly damaging 0.48
R7446:Oas1d UTSW 5 120919991 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCAGTGTAAGGAGAAGCTG -3'
(R):5'- ATGTCAGAGCCTTGGTCTCC -3'

Sequencing Primer
(F):5'- GAGAAGCTGAGGGGGCC -3'
(R):5'- TTGGTCTCCTCATCACAGACAAG -3'
Posted On2015-08-18