Incidental Mutation 'R4516:Vps26a'
ID332922
Institutional Source Beutler Lab
Gene Symbol Vps26a
Ensembl Gene ENSMUSG00000020078
Gene NameVPS26 retromer complex component A
SynonymsVps26, H beta 58, HB58
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62455235-62486805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62468345 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 116 (M116V)
Ref Sequence ENSEMBL: ENSMUSP00000151888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092473] [ENSMUST00000105447] [ENSMUST00000217868] [ENSMUST00000219574]
Predicted Effect probably benign
Transcript: ENSMUST00000092473
AA Change: M198V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090130
Gene: ENSMUSG00000020078
AA Change: M198V

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
Pfam:Vps26 40 315 3.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105447
AA Change: M166V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101087
Gene: ENSMUSG00000020078
AA Change: M166V

DomainStartEndE-ValueType
Pfam:Vps26 8 283 2.7e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217868
AA Change: M116V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219574
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null mutation induced by transgene insertion exhibit retarded growth of the embryonic ectoderm beginning at embryonic day 7.5 and often, defects of the amnion and chorion. Mutant embryos arrest about day 9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Other mutations in Vps26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0566:Vps26a UTSW 10 62480546 splice site probably benign
R0801:Vps26a UTSW 10 62459078 splice site probably benign
R0856:Vps26a UTSW 10 62468410 missense possibly damaging 0.84
R1563:Vps26a UTSW 10 62464680 missense probably benign 0.18
R1785:Vps26a UTSW 10 62468397 missense probably benign 0.01
R1833:Vps26a UTSW 10 62459046 missense probably benign 0.00
R2173:Vps26a UTSW 10 62468392 missense probably damaging 1.00
R5339:Vps26a UTSW 10 62458967 missense probably damaging 1.00
R5391:Vps26a UTSW 10 62456747 makesense probably null
R5646:Vps26a UTSW 10 62468298 missense probably damaging 1.00
R6154:Vps26a UTSW 10 62468340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTGGCTGGTAAAGATG -3'
(R):5'- GCTCACATCTGAGTTCTTTATGG -3'

Sequencing Primer
(F):5'- TGGCTGGTAAAGATGAAAATTATGTC -3'
(R):5'- AAAGCTGAGCTGGCTGC -3'
Posted On2015-08-18