Incidental Mutation 'R4528:Zfpm1'
ID333000
Institutional Source Beutler Lab
Gene Symbol Zfpm1
Ensembl Gene ENSMUSG00000049577
Gene Namezinc finger protein, multitype 1
SynonymsFog1, Friend of GATA-1
MMRRC Submission 041769-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R4528 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122282141-122337251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122335642 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 480 (R480H)
Ref Sequence ENSEMBL: ENSMUSP00000058037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]
PDB Structure
Solution structure of the third zinc finger domain of FOG-1 [SOLUTION NMR]
Solution structure of the PR domain of FOG-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000054052
AA Change: R480H

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: R480H

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
ZnF_C2H2 255 275 3.13e1 SMART
ZnF_C2H2 303 327 1.69e-3 SMART
ZnF_C2H2 333 355 1.53e-1 SMART
ZnF_C2H2 361 384 9.46e0 SMART
low complexity region 508 525 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
ZnF_C2H2 590 610 1.41e2 SMART
low complexity region 626 643 N/A INTRINSIC
low complexity region 644 663 N/A INTRINSIC
ZnF_C2H2 696 723 1.78e2 SMART
low complexity region 725 755 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
low complexity region 785 806 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ZnF_C2H2 836 856 7.77e1 SMART
ZnF_C2H2 868 891 1.96e1 SMART
low complexity region 948 961 N/A INTRINSIC
ZnF_C2H2 963 989 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176690
SMART Domains Protein: ENSMUSP00000135092
Gene: ENSMUSG00000049577

DomainStartEndE-ValueType
ZnF_C2H2 51 71 3.13e1 SMART
ZnF_C2H2 99 123 1.69e-3 SMART
ZnF_C2H2 129 151 1.53e-1 SMART
ZnF_C2H2 157 180 9.46e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212315
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm A T 9: 53,500,759 I999K probably benign Het
Camsap3 A G 8: 3,606,515 E535G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpu G T 8: 46,562,422 G34* probably null Het
Col7a1 C A 9: 108,959,533 A739D unknown Het
Coro1b T C 19: 4,149,981 V107A probably benign Het
Cpeb3 T C 19: 37,139,088 D381G possibly damaging Het
Cyp2a22 T C 7: 26,934,769 D320G possibly damaging Het
Dcaf1 A T 9: 106,844,204 K398N probably damaging Het
Etfa A G 9: 55,500,050 S52P probably damaging Het
Fat4 T A 3: 38,891,294 H1445Q probably benign Het
Foxred2 T A 15: 77,943,249 M637L probably benign Het
Gbe1 A T 16: 70,478,337 I342L probably benign Het
Gm14410 G T 2: 177,193,941 H177N probably damaging Het
Gm14410 A T 2: 177,193,943 I176K probably benign Het
Gm1527 T A 3: 28,914,393 M198K probably damaging Het
Hr T C 14: 70,566,383 L838P probably damaging Het
Kmt2e T C 5: 23,473,558 S212P possibly damaging Het
Lims1 T C 10: 58,410,060 C180R probably damaging Het
Mki67 A T 7: 135,695,359 S2649T probably damaging Het
Olfr1308 T C 2: 111,960,948 N42D probably damaging Het
Olfr417 T A 1: 174,369,256 L113H probably damaging Het
Olfr574 A G 7: 102,948,806 M104V probably damaging Het
Pde4dip C T 3: 97,717,022 E1399K probably damaging Het
Pex1 T C 5: 3,631,712 Y1053H probably damaging Het
Plscr2 G A 9: 92,289,693 E113K possibly damaging Het
Pus1 T C 5: 110,774,730 Y309C probably damaging Het
Scube3 T A 17: 28,162,999 V333D possibly damaging Het
Serpina11 A T 12: 103,986,333 N66K probably benign Het
Thtpa T A 14: 55,095,582 D41E probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Tlr12 A C 4: 128,618,025 L144R probably damaging Het
Uba7 A G 9: 107,983,903 E964G possibly damaging Het
Ugt1a6b T A 1: 88,107,579 I213N probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zbtb43 A G 2: 33,462,325 probably benign Het
Zfp985 A T 4: 147,582,890 I72F possibly damaging Het
Other mutations in Zfpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Zfpm1 APN 8 122332120 missense possibly damaging 0.65
R0006:Zfpm1 UTSW 8 122334488 missense probably damaging 1.00
R0508:Zfpm1 UTSW 8 122335133 missense probably damaging 1.00
R0631:Zfpm1 UTSW 8 122336874 intron probably benign
R0729:Zfpm1 UTSW 8 122336659 missense probably benign 0.20
R0883:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1509:Zfpm1 UTSW 8 122307546 missense possibly damaging 0.63
R1938:Zfpm1 UTSW 8 122334924 splice site probably null
R2060:Zfpm1 UTSW 8 122336592 missense probably benign 0.37
R3735:Zfpm1 UTSW 8 122323736 missense possibly damaging 0.83
R3736:Zfpm1 UTSW 8 122323736 missense possibly damaging 0.83
R4735:Zfpm1 UTSW 8 122335480 missense probably benign 0.24
R4924:Zfpm1 UTSW 8 122334608 missense possibly damaging 0.95
R5347:Zfpm1 UTSW 8 122335530 missense possibly damaging 0.94
R5375:Zfpm1 UTSW 8 122336073 missense probably benign 0.00
R5470:Zfpm1 UTSW 8 122333793 missense probably damaging 0.99
R6358:Zfpm1 UTSW 8 122337111 intron probably benign
R6768:Zfpm1 UTSW 8 122334456 missense probably damaging 1.00
R6966:Zfpm1 UTSW 8 122332165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCAGCCCTGTGTTCTTGTAG -3'
(R):5'- CGTCCGGACTGAACACATATTG -3'

Sequencing Primer
(F):5'- TCTTGTAGACAGCCTGGCAG -3'
(R):5'- CATATTGTGGCAGAAAGAGTGTCCC -3'
Posted On2015-08-18