Incidental Mutation 'R4528:Foxred2'
ID333011
Institutional Source Beutler Lab
Gene Symbol Foxred2
Ensembl Gene ENSMUSG00000016552
Gene NameFAD-dependent oxidoreductase domain containing 2
SynonymsD15Bwg0759e, A430097D04Rik, LOC239554
MMRRC Submission 041769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4528 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77940522-77956722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77943249 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 637 (M637L)
Ref Sequence ENSEMBL: ENSMUSP00000016696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000117725]
Predicted Effect probably benign
Transcript: ENSMUST00000016696
AA Change: M637L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552
AA Change: M637L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117725
AA Change: M637L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552
AA Change: M637L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140096
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm A T 9: 53,500,759 I999K probably benign Het
Camsap3 A G 8: 3,606,515 E535G possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpu G T 8: 46,562,422 G34* probably null Het
Col7a1 C A 9: 108,959,533 A739D unknown Het
Coro1b T C 19: 4,149,981 V107A probably benign Het
Cpeb3 T C 19: 37,139,088 D381G possibly damaging Het
Cyp2a22 T C 7: 26,934,769 D320G possibly damaging Het
Dcaf1 A T 9: 106,844,204 K398N probably damaging Het
Etfa A G 9: 55,500,050 S52P probably damaging Het
Fat4 T A 3: 38,891,294 H1445Q probably benign Het
Gbe1 A T 16: 70,478,337 I342L probably benign Het
Gm14410 G T 2: 177,193,941 H177N probably damaging Het
Gm14410 A T 2: 177,193,943 I176K probably benign Het
Gm1527 T A 3: 28,914,393 M198K probably damaging Het
Hr T C 14: 70,566,383 L838P probably damaging Het
Kmt2e T C 5: 23,473,558 S212P possibly damaging Het
Lims1 T C 10: 58,410,060 C180R probably damaging Het
Mki67 A T 7: 135,695,359 S2649T probably damaging Het
Olfr1308 T C 2: 111,960,948 N42D probably damaging Het
Olfr417 T A 1: 174,369,256 L113H probably damaging Het
Olfr574 A G 7: 102,948,806 M104V probably damaging Het
Pde4dip C T 3: 97,717,022 E1399K probably damaging Het
Pex1 T C 5: 3,631,712 Y1053H probably damaging Het
Plscr2 G A 9: 92,289,693 E113K possibly damaging Het
Pus1 T C 5: 110,774,730 Y309C probably damaging Het
Scube3 T A 17: 28,162,999 V333D possibly damaging Het
Serpina11 A T 12: 103,986,333 N66K probably benign Het
Thtpa T A 14: 55,095,582 D41E probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Tlr12 A C 4: 128,618,025 L144R probably damaging Het
Uba7 A G 9: 107,983,903 E964G possibly damaging Het
Ugt1a6b T A 1: 88,107,579 I213N probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zbtb43 A G 2: 33,462,325 probably benign Het
Zfp985 A T 4: 147,582,890 I72F possibly damaging Het
Zfpm1 G A 8: 122,335,642 R480H probably benign Het
Other mutations in Foxred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Foxred2 APN 15 77955620 missense probably benign 0.30
IGL01479:Foxred2 APN 15 77952289 splice site probably null
IGL01748:Foxred2 APN 15 77952346 missense probably damaging 1.00
IGL02160:Foxred2 APN 15 77955650 missense probably benign 0.03
IGL02328:Foxred2 APN 15 77955832 missense probably damaging 1.00
IGL02630:Foxred2 APN 15 77947162 missense probably benign 0.05
IGL02672:Foxred2 APN 15 77945577 critical splice donor site probably null
soma UTSW 15 77953358 missense possibly damaging 0.78
R0271:Foxred2 UTSW 15 77943390 missense possibly damaging 0.68
R1386:Foxred2 UTSW 15 77948521 critical splice acceptor site probably null
R1581:Foxred2 UTSW 15 77955761 missense possibly damaging 0.94
R4399:Foxred2 UTSW 15 77953358 missense possibly damaging 0.78
R4399:Foxred2 UTSW 15 77955680 missense probably benign 0.06
R4937:Foxred2 UTSW 15 77955835 missense probably damaging 1.00
R5165:Foxred2 UTSW 15 77956012 missense probably damaging 1.00
R5318:Foxred2 UTSW 15 77952398 missense probably benign 0.00
R5893:Foxred2 UTSW 15 77947144 missense probably damaging 1.00
R6336:Foxred2 UTSW 15 77955764 missense probably damaging 0.99
R6370:Foxred2 UTSW 15 77943306 missense probably benign 0.01
R6426:Foxred2 UTSW 15 77953308 missense probably damaging 1.00
R6826:Foxred2 UTSW 15 77947085 missense probably benign 0.01
R6891:Foxred2 UTSW 15 77955709 missense probably damaging 1.00
R6934:Foxred2 UTSW 15 77952330 nonsense probably null
R7193:Foxred2 UTSW 15 77952030 missense probably damaging 1.00
Z1088:Foxred2 UTSW 15 77952003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTCTGCACTCTATGGG -3'
(R):5'- GTTACCTAGGTCCCCAGCATTG -3'

Sequencing Primer
(F):5'- GCACTCTATGGGCAGTCC -3'
(R):5'- TGTCTCCCAAGCCTGGC -3'
Posted On2015-08-18