Incidental Mutation 'R4530:Axin1'
ID333094
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission 041770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4530 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26188172 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 580 (Y580N)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect probably benign
Transcript: ENSMUST00000074370
AA Change: Y580N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: Y580N

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
AA Change: Y580N

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: Y580N

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163421
AA Change: Y580N

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: Y580N

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169268
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 T C 14: 55,779,028 D322G probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Arhgap42 T C 9: 9,011,432 D451G probably damaging Het
Arhgef7 T C 8: 11,800,802 M144T possibly damaging Het
Arid4b C A 13: 14,126,455 T41N probably damaging Het
Cdc27 T C 11: 104,528,426 N227D possibly damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Clec2h A G 6: 128,662,494 D18G possibly damaging Het
Clec4e T C 6: 123,289,774 probably benign Het
Cntnap4 T C 8: 112,858,210 I1093T probably benign Het
Dner G T 1: 84,583,015 N136K probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gpr158 A G 2: 21,369,000 S249G probably benign Het
Il16 A C 7: 83,681,310 probably benign Het
Intu T G 3: 40,683,364 C427G possibly damaging Het
Kif21a A C 15: 90,968,089 probably null Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Mroh7 T C 4: 106,720,437 E348G possibly damaging Het
Olfr1085 T C 2: 86,657,561 D299G probably benign Het
Olfr93 C T 17: 37,151,607 V122M possibly damaging Het
Olfr971 G T 9: 39,840,083 M216I probably benign Het
Olfr981 G A 9: 40,023,293 R300K probably benign Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Prss43 A T 9: 110,829,504 M291L probably benign Het
Rap1gds1 T C 3: 138,957,425 N338D probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Stip1 G T 19: 7,035,658 N19K probably benign Het
Tat T A 8: 109,996,210 F301L probably benign Het
Tmprss11a C A 5: 86,428,681 V104L possibly damaging Het
Ttc3 T A 16: 94,466,877 probably benign Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Vcan A T 13: 89,704,028 F938I probably damaging Het
Wrap73 A G 4: 154,156,707 probably benign Het
Xndc1 C A 7: 102,078,735 N85K probably benign Het
Zfp282 C T 6: 47,890,633 P248S probably benign Het
Zfp930 C T 8: 69,228,831 Q393* probably null Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGACTGCAGTGCTAGGGG -3'
(R):5'- TCCAGTCATAGCAAGGCCTG -3'

Sequencing Primer
(F):5'- CGGGCATGGGAAGCATGTTC -3'
(R):5'- TCATAGCAAGGCCTGGAGTCTG -3'
Posted On2015-08-18