Incidental Mutation 'R4531:Cntnap4'
ID 333117
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Name contactin associated protein-like 4
Synonyms Caspr4, E130114F09Rik
MMRRC Submission 041771-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4531 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 113296675-113609349 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113537240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 704 (V704M)
Ref Sequence ENSEMBL: ENSMUSP00000112511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
AlphaFold Q99P47
Predicted Effect possibly damaging
Transcript: ENSMUST00000034225
AA Change: V704M

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: V704M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118171
AA Change: V704M

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: V704M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125976
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,736,962 (GRCm39) T526A probably benign Het
Acad12 T C 5: 121,736,964 (GRCm39) Q525R probably benign Het
Cnot3 T C 7: 3,661,073 (GRCm39) V558A probably benign Het
Col22a1 T C 15: 71,878,998 (GRCm39) D53G probably damaging Het
Cspp1 T A 1: 10,137,072 (GRCm39) probably benign Het
Cyp2d10 T A 15: 82,289,462 (GRCm39) T217S probably benign Het
Dcaf6 T C 1: 165,239,036 (GRCm39) T229A probably damaging Het
E4f1 A T 17: 24,664,961 (GRCm39) S408T possibly damaging Het
Eif1ad19 G A 12: 87,740,314 (GRCm39) Q82* probably null Het
Gpr149 A G 3: 62,510,099 (GRCm39) F339L probably benign Het
Hmbox1 A T 14: 65,062,938 (GRCm39) C413S probably benign Het
Kmo T C 1: 175,487,273 (GRCm39) probably null Het
Lin54 G A 5: 100,594,419 (GRCm39) T582I possibly damaging Het
Lrpprc T C 17: 85,020,215 (GRCm39) I1157V probably benign Het
Obscn A G 11: 58,898,700 (GRCm39) probably benign Het
Or14c40 T A 7: 86,313,479 (GRCm39) L203H probably benign Het
Or8k23 A T 2: 86,186,318 (GRCm39) M136K probably damaging Het
Pclo A G 5: 14,825,422 (GRCm39) D4657G unknown Het
Pgd T C 4: 149,241,234 (GRCm39) K225R probably benign Het
Poli A T 18: 70,650,548 (GRCm39) H297Q probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc24a2 T C 4: 86,909,715 (GRCm39) I668V possibly damaging Het
Tdrd6 A G 17: 43,939,645 (GRCm39) S468P probably damaging Het
Trav6-4 A G 14: 53,691,790 (GRCm39) T3A probably benign Het
Trpc2 G T 7: 101,745,205 (GRCm39) R807L probably damaging Het
Ttc3 T A 16: 94,267,736 (GRCm39) probably benign Het
Tubgcp3 G T 8: 12,713,932 (GRCm39) L62I probably damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vwce A C 19: 10,641,710 (GRCm39) E812A probably benign Het
Zmynd12 T C 4: 119,280,194 (GRCm39) probably null Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 113,494,251 (GRCm39) splice site probably benign
IGL01898:Cntnap4 APN 8 113,582,939 (GRCm39) missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 113,478,866 (GRCm39) missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 113,343,126 (GRCm39) missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 113,512,535 (GRCm39) splice site probably benign
IGL02621:Cntnap4 APN 8 113,537,355 (GRCm39) missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 113,500,222 (GRCm39) missense probably benign 0.06
IGL03327:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
IGL03346:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 113,512,416 (GRCm39) missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 113,569,148 (GRCm39) critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 113,583,143 (GRCm39) nonsense probably null
R0497:Cntnap4 UTSW 8 113,296,783 (GRCm39) missense probably benign 0.00
R1495:Cntnap4 UTSW 8 113,608,395 (GRCm39) missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 113,608,462 (GRCm39) missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 113,484,155 (GRCm39) missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 113,542,128 (GRCm39) missense probably benign 0.10
R2160:Cntnap4 UTSW 8 113,484,203 (GRCm39) missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 113,484,071 (GRCm39) missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R3917:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R4097:Cntnap4 UTSW 8 113,478,939 (GRCm39) missense probably benign 0.03
R4348:Cntnap4 UTSW 8 113,480,554 (GRCm39) missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 113,391,898 (GRCm39) missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 113,584,842 (GRCm39) missense probably benign 0.32
R4586:Cntnap4 UTSW 8 113,537,342 (GRCm39) missense probably benign
R4611:Cntnap4 UTSW 8 113,500,371 (GRCm39) critical splice donor site probably null
R4675:Cntnap4 UTSW 8 113,512,468 (GRCm39) missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 113,460,070 (GRCm39) missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 113,568,385 (GRCm39) missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 113,602,061 (GRCm39) missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 113,569,353 (GRCm39) missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 113,529,843 (GRCm39) missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 113,478,921 (GRCm39) missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 113,484,105 (GRCm39) missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 113,529,858 (GRCm39) missense probably benign 0.03
R7031:Cntnap4 UTSW 8 113,584,874 (GRCm39) missense probably benign 0.01
R7107:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 113,537,268 (GRCm39) missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 113,608,432 (GRCm39) missense probably benign 0.05
R7232:Cntnap4 UTSW 8 113,391,731 (GRCm39) splice site probably null
R7348:Cntnap4 UTSW 8 113,391,909 (GRCm39) missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 113,460,194 (GRCm39) critical splice donor site probably null
R7832:Cntnap4 UTSW 8 113,484,113 (GRCm39) missense probably benign
R7895:Cntnap4 UTSW 8 113,478,829 (GRCm39) missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 113,480,577 (GRCm39) missense probably damaging 0.99
R8185:Cntnap4 UTSW 8 113,391,897 (GRCm39) missense probably damaging 1.00
R8197:Cntnap4 UTSW 8 113,296,857 (GRCm39) missense probably benign 0.00
R8287:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
R8299:Cntnap4 UTSW 8 113,500,324 (GRCm39) missense probably damaging 1.00
R8498:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense possibly damaging 0.52
R8699:Cntnap4 UTSW 8 113,484,228 (GRCm39) missense probably damaging 1.00
R8774:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8774-TAIL:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8872:Cntnap4 UTSW 8 113,585,759 (GRCm39) missense possibly damaging 0.79
R8895:Cntnap4 UTSW 8 113,479,598 (GRCm39) missense probably benign 0.40
R8965:Cntnap4 UTSW 8 113,479,646 (GRCm39) missense probably damaging 1.00
R9189:Cntnap4 UTSW 8 113,602,600 (GRCm39) missense possibly damaging 0.92
R9260:Cntnap4 UTSW 8 113,500,276 (GRCm39) missense probably benign 0.08
R9474:Cntnap4 UTSW 8 113,460,103 (GRCm39) missense probably damaging 0.99
R9565:Cntnap4 UTSW 8 113,582,982 (GRCm39) missense probably benign 0.43
R9625:Cntnap4 UTSW 8 113,602,181 (GRCm39) missense possibly damaging 0.82
R9629:Cntnap4 UTSW 8 113,568,349 (GRCm39) missense probably damaging 1.00
R9745:Cntnap4 UTSW 8 113,391,808 (GRCm39) missense possibly damaging 0.89
R9765:Cntnap4 UTSW 8 113,568,496 (GRCm39) missense probably damaging 0.97
R9765:Cntnap4 UTSW 8 113,484,110 (GRCm39) missense probably benign 0.00
R9793:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
R9795:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
X0025:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 113,542,152 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 113,584,821 (GRCm39) missense possibly damaging 0.70
Z1186:Cntnap4 UTSW 8 113,479,002 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGGGTATTATTACACCACATCGG -3'
(R):5'- ATCCATGAAGCTGCATACCC -3'

Sequencing Primer
(F):5'- ACATCGGTCTCTTTTCTGTCTATG -3'
(R):5'- TGAAGCTGCATACCCTTGACG -3'
Posted On 2015-08-18