Incidental Mutation 'R4533:Uap1'
ID333179
Institutional Source Beutler Lab
Gene Symbol Uap1
Ensembl Gene ENSMUSG00000026670
Gene NameUDP-N-acetylglucosamine pyrophosphorylase 1
SynonymsESTM38, SPAG2, AgX, AGX1
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170141938-170174957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 170143425 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 466 (I466N)
Ref Sequence ENSEMBL: ENSMUSP00000106982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027981] [ENSMUST00000111350] [ENSMUST00000111351]
Predicted Effect probably damaging
Transcript: ENSMUST00000027981
AA Change: I482N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027981
Gene: ENSMUSG00000026670
AA Change: I482N

DomainStartEndE-ValueType
Pfam:UDPGP 44 471 2e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111350
AA Change: I466N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106982
Gene: ENSMUSG00000026670
AA Change: I466N

DomainStartEndE-ValueType
Pfam:UDPGP 44 467 5.3e-124 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111351
AA Change: I483N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106983
Gene: ENSMUSG00000026670
AA Change: I483N

DomainStartEndE-ValueType
Pfam:UDPGP 45 472 4.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161492
Meta Mutation Damage Score 0.486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Uap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Uap1 APN 1 170166712 missense probably benign 0.22
IGL02330:Uap1 APN 1 170150327 missense possibly damaging 0.94
IGL03383:Uap1 APN 1 170158891 missense probably damaging 1.00
R0382:Uap1 UTSW 1 170161482 missense probably benign 0.00
R0696:Uap1 UTSW 1 170149274 missense probably benign 0.23
R1055:Uap1 UTSW 1 170156911 splice site probably benign
R1463:Uap1 UTSW 1 170150383 missense probably benign
R1522:Uap1 UTSW 1 170150941 critical splice donor site probably null
R2257:Uap1 UTSW 1 170158743 splice site probably benign
R4061:Uap1 UTSW 1 170158846 missense possibly damaging 0.71
R5068:Uap1 UTSW 1 170161463 missense probably damaging 0.98
R5341:Uap1 UTSW 1 170143431 missense probably damaging 1.00
R5712:Uap1 UTSW 1 170166845 missense possibly damaging 0.87
R5772:Uap1 UTSW 1 170161380 missense probably benign 0.20
R5869:Uap1 UTSW 1 170151138 critical splice acceptor site probably null
R6229:Uap1 UTSW 1 170166733 missense probably benign
R7216:Uap1 UTSW 1 170158903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGTCCCTGCTCTGTAAAG -3'
(R):5'- ATTGTAGAGGAGGCTCCAGG -3'

Sequencing Primer
(F):5'- AAGTCCCTGCTCTGTAAAGCTTAC -3'
(R):5'- CAGGGTAGGCTCCATTCTTTAACTAG -3'
Posted On2015-08-18