Incidental Mutation 'R4533:Raly'
ID333185
Institutional Source Beutler Lab
Gene Symbol Raly
Ensembl Gene ENSMUSG00000027593
Gene NamehnRNP-associated with lethal yellow
SynonymsMerc
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154791096-154867261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154865933 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 291 (E291V)
Ref Sequence ENSEMBL: ENSMUSP00000105323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029120] [ENSMUST00000058089] [ENSMUST00000109701] [ENSMUST00000116389] [ENSMUST00000125872] [ENSMUST00000129137] [ENSMUST00000137333] [ENSMUST00000140713]
Predicted Effect probably damaging
Transcript: ENSMUST00000029120
AA Change: E307V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029120
Gene: ENSMUSG00000027593
AA Change: E307V

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
low complexity region 287 301 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058089
AA Change: E291V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058105
Gene: ENSMUSG00000027593
AA Change: E291V

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 117 144 N/A INTRINSIC
low complexity region 211 243 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109701
AA Change: E291V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105323
Gene: ENSMUSG00000027593
AA Change: E291V

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 117 144 N/A INTRINSIC
low complexity region 211 243 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116389
AA Change: E307V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112090
Gene: ENSMUSG00000027593
AA Change: E307V

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
low complexity region 287 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125872
SMART Domains Protein: ENSMUSP00000119108
Gene: ENSMUSG00000027593

DomainStartEndE-ValueType
RRM 22 88 1.6e-16 SMART
low complexity region 120 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129137
SMART Domains Protein: ENSMUSP00000114185
Gene: ENSMUSG00000027593

DomainStartEndE-ValueType
RRM 22 88 1.6e-16 SMART
low complexity region 117 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137333
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140713
SMART Domains Protein: ENSMUSP00000119126
Gene: ENSMUSG00000027593

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) gene family. This protein may play a role in pre-mRNA splicing and in embryonic development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Raly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Raly APN 2 154859670 splice site probably benign
IGL02164:Raly APN 2 154859929 nonsense probably null
R0227:Raly UTSW 2 154865921 missense probably damaging 0.98
R1412:Raly UTSW 2 154857395 missense possibly damaging 0.95
R1416:Raly UTSW 2 154857353 nonsense probably null
R2247:Raly UTSW 2 154864033 missense possibly damaging 0.92
R4110:Raly UTSW 2 154857458 nonsense probably null
R4654:Raly UTSW 2 154857456 missense probably damaging 1.00
R4866:Raly UTSW 2 154861896 missense probably damaging 0.99
R5395:Raly UTSW 2 154864007 unclassified probably null
R6254:Raly UTSW 2 154857366 missense probably damaging 1.00
R6887:Raly UTSW 2 154861910 missense probably damaging 0.99
R7069:Raly UTSW 2 154859744 missense possibly damaging 0.93
R7117:Raly UTSW 2 154857512 missense probably benign 0.35
R7289:Raly UTSW 2 154861854 missense probably damaging 1.00
R7311:Raly UTSW 2 154857420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATCTTCAAATGACCCTCTCG -3'
(R):5'- AGTCATTCGTTCACAAGAGAACC -3'

Sequencing Primer
(F):5'- CTCTCGGGATTCTAAGCCAG -3'
(R):5'- CGTTCACAAGAGAACCTTTTCTAG -3'
Posted On2015-08-18