Incidental Mutation 'R4533:Ago3'
ID333189
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
MMRRC Submission 041773-MU
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126345563 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 832 (S832T)
Ref Sequence ENSEMBL: ENSMUSP00000066633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097] [ENSMUST00000127831] [ENSMUST00000132123]
Predicted Effect probably damaging
Transcript: ENSMUST00000069097
AA Change: S832T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: S832T

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127831
SMART Domains Protein: ENSMUSP00000118577
Gene: ENSMUSG00000028842

DomainStartEndE-ValueType
Piwi 1 125 9.56e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132123
SMART Domains Protein: ENSMUSP00000116204
Gene: ENSMUSG00000028842

DomainStartEndE-ValueType
Piwi 1 140 1.41e-19 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2239:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4272:Ago3 UTSW 4 126355091 missense possibly damaging 0.95
R4575:Ago3 UTSW 4 126346682 missense probably benign 0.06
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5180:Ago3 UTSW 4 126367751 missense probably benign 0.01
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126355050 missense probably damaging 1.00
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCAAATTGACTCCATTGGAAAC -3'
(R):5'- GTTGCTTCTCCAAATTATCCTAGG -3'

Sequencing Primer
(F):5'- TGACTCCATTGGAAACATACATTG -3'
(R):5'- TATGACAAAATGATATGGTGTCTGGG -3'
Posted On2015-08-18