Incidental Mutation 'R4533:Slc12a3'
ID333206
Institutional Source Beutler Lab
Gene Symbol Slc12a3
Ensembl Gene ENSMUSG00000031766
Gene Namesolute carrier family 12, member 3
SynonymsNCC, TSC
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94329201-94366214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94357086 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 914 (M914V)
Ref Sequence ENSEMBL: ENSMUSP00000034218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034218] [ENSMUST00000212134]
Predicted Effect probably null
Transcript: ENSMUST00000034218
AA Change: M914V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: M914V

DomainStartEndE-ValueType
Pfam:AA_permease_N 43 114 1.5e-30 PFAM
Pfam:AA_permease 139 645 3.6e-145 PFAM
Pfam:SLC12 653 801 1.4e-53 PFAM
Pfam:SLC12 787 1001 2e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211905
AA Change: M55V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211942
Predicted Effect probably null
Transcript: ENSMUST00000212134
AA Change: M914V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212632
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Slc12a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Slc12a3 APN 8 94357096 missense probably benign 0.00
IGL01947:Slc12a3 APN 8 94365819 critical splice acceptor site probably null
IGL02151:Slc12a3 APN 8 94348592 missense probably benign 0.26
IGL02440:Slc12a3 APN 8 94331682 missense probably damaging 1.00
IGL03213:Slc12a3 APN 8 94335305 missense possibly damaging 0.95
IGL03260:Slc12a3 APN 8 94333242 missense probably damaging 1.00
IGL03306:Slc12a3 APN 8 94351758 missense possibly damaging 0.72
IGL03329:Slc12a3 APN 8 94365891 missense possibly damaging 0.67
Pugilist UTSW 8 94345773 critical splice acceptor site probably null
R0131:Slc12a3 UTSW 8 94340883 splice site probably benign
R0189:Slc12a3 UTSW 8 94356358 missense probably benign 0.30
R0330:Slc12a3 UTSW 8 94346346 missense possibly damaging 0.75
R0569:Slc12a3 UTSW 8 94330525 critical splice donor site probably null
R0715:Slc12a3 UTSW 8 94329433 missense possibly damaging 0.75
R1248:Slc12a3 UTSW 8 94333277 missense probably damaging 1.00
R1565:Slc12a3 UTSW 8 94345877 missense possibly damaging 0.75
R2068:Slc12a3 UTSW 8 94345828 missense probably damaging 1.00
R2108:Slc12a3 UTSW 8 94340530 missense probably damaging 0.97
R2273:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2274:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2275:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2433:Slc12a3 UTSW 8 94346316 missense probably benign 0.00
R3770:Slc12a3 UTSW 8 94353040 missense probably benign
R4429:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4431:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4627:Slc12a3 UTSW 8 94329384 missense probably benign
R4856:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4886:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4908:Slc12a3 UTSW 8 94348588 missense possibly damaging 0.76
R5054:Slc12a3 UTSW 8 94346351 missense probably damaging 1.00
R5299:Slc12a3 UTSW 8 94351789 missense probably damaging 1.00
R5451:Slc12a3 UTSW 8 94357027 missense possibly damaging 0.61
R5590:Slc12a3 UTSW 8 94345788 missense probably damaging 1.00
R5725:Slc12a3 UTSW 8 94330446 missense probably benign 0.00
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6162:Slc12a3 UTSW 8 94345773 critical splice acceptor site probably null
R6266:Slc12a3 UTSW 8 94358471 missense possibly damaging 0.93
R6489:Slc12a3 UTSW 8 94335004 missense possibly damaging 0.96
R6521:Slc12a3 UTSW 8 94343113 missense possibly damaging 0.84
R6882:Slc12a3 UTSW 8 94365918 missense possibly damaging 0.51
R7051:Slc12a3 UTSW 8 94365944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGCTGGATGGGTTCAG -3'
(R):5'- GGCCCAAGAACATCTCAGACATTG -3'

Sequencing Primer
(F):5'- ATGGGTTCAGTGAGAGGAGTATGTC -3'
(R):5'- CATCTCAGACATTGCTAAGGGTG -3'
Posted On2015-08-18