Incidental Mutation 'R4533:Tex14'
ID333212
Institutional Source Beutler Lab
Gene Symbol Tex14
Ensembl Gene ENSMUSG00000010342
Gene Nametestis expressed gene 14
Synonyms
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87405065-87555823 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 87536829 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 36 (R36*)
Ref Sequence ENSEMBL: ENSMUSP00000117564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060835] [ENSMUST00000100657] [ENSMUST00000131973]
Predicted Effect probably null
Transcript: ENSMUST00000060835
AA Change: R1216*
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: R1216*

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100657
Predicted Effect probably null
Transcript: ENSMUST00000131973
AA Change: R36*
SMART Domains Protein: ENSMUSP00000117564
Gene: ENSMUSG00000010342
AA Change: R36*

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Meta Mutation Damage Score 0.66 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Tex14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tex14 APN 11 87535643 missense probably damaging 0.98
IGL00494:Tex14 APN 11 87555484 missense probably damaging 1.00
IGL01604:Tex14 APN 11 87509698 missense possibly damaging 0.63
IGL02690:Tex14 APN 11 87486274 missense probably benign 0.11
IGL02888:Tex14 APN 11 87527912 critical splice donor site probably null
IGL03073:Tex14 APN 11 87535609 missense probably damaging 0.99
IGL03109:Tex14 APN 11 87543365 missense probably damaging 1.00
IGL03047:Tex14 UTSW 11 87536704 missense probably damaging 1.00
R0141:Tex14 UTSW 11 87493031 splice site probably null
R0455:Tex14 UTSW 11 87514305 missense possibly damaging 0.93
R0624:Tex14 UTSW 11 87520699 missense probably benign 0.19
R0718:Tex14 UTSW 11 87499613 missense probably benign 0.20
R1077:Tex14 UTSW 11 87519745 splice site probably benign
R1118:Tex14 UTSW 11 87522517 missense probably benign 0.07
R1120:Tex14 UTSW 11 87538676 splice site probably benign
R1168:Tex14 UTSW 11 87536742 missense probably benign 0.11
R1190:Tex14 UTSW 11 87495108 intron probably null
R1470:Tex14 UTSW 11 87549529 splice site probably benign
R1563:Tex14 UTSW 11 87536808 missense probably damaging 0.99
R1607:Tex14 UTSW 11 87554928 missense probably damaging 1.00
R1696:Tex14 UTSW 11 87511545 missense possibly damaging 0.49
R1873:Tex14 UTSW 11 87499605 missense probably damaging 1.00
R1894:Tex14 UTSW 11 87474448 missense probably damaging 1.00
R1911:Tex14 UTSW 11 87495035 missense probably damaging 1.00
R1955:Tex14 UTSW 11 87509621 missense probably damaging 1.00
R1971:Tex14 UTSW 11 87511605 missense probably damaging 1.00
R1990:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1991:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1993:Tex14 UTSW 11 87536755 missense possibly damaging 0.57
R2106:Tex14 UTSW 11 87486250 missense possibly damaging 0.47
R2118:Tex14 UTSW 11 87519743 splice site probably benign
R2860:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R2861:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R4016:Tex14 UTSW 11 87538623 unclassified probably null
R4089:Tex14 UTSW 11 87512203 missense probably damaging 1.00
R4158:Tex14 UTSW 11 87516769 missense probably benign 0.06
R4713:Tex14 UTSW 11 87536865 missense probably damaging 0.99
R4758:Tex14 UTSW 11 87514485 missense probably benign 0.00
R4880:Tex14 UTSW 11 87486295 missense possibly damaging 0.95
R4953:Tex14 UTSW 11 87536901 critical splice donor site probably null
R5092:Tex14 UTSW 11 87514842 missense probably benign 0.03
R5119:Tex14 UTSW 11 87433813 missense probably damaging 1.00
R5322:Tex14 UTSW 11 87511472 missense probably benign 0.04
R5470:Tex14 UTSW 11 87551604 missense probably damaging 0.99
R5607:Tex14 UTSW 11 87522578 missense probably benign 0.00
R5642:Tex14 UTSW 11 87514220 missense probably benign
R5643:Tex14 UTSW 11 87535626 missense probably damaging 1.00
R5786:Tex14 UTSW 11 87514295 missense probably damaging 0.97
R6478:Tex14 UTSW 11 87514373 missense probably benign
R6560:Tex14 UTSW 11 87497862 missense possibly damaging 0.95
R6661:Tex14 UTSW 11 87495016 missense probably damaging 1.00
R7037:Tex14 UTSW 11 87497915 missense probably damaging 1.00
R7156:Tex14 UTSW 11 87484719 missense probably damaging 0.99
X0017:Tex14 UTSW 11 87535549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTCTCAGATTCATGGTTG -3'
(R):5'- CCATGTTTCTCAACAAATCTGGAG -3'

Sequencing Primer
(F):5'- CTGTCTCAGATTCATGGTTGTTTCAG -3'
(R):5'- TGGAGAAACCTTAGCCCTTTCAG -3'
Posted On2015-08-18