Incidental Mutation 'R4533:Ptchd3'
ID333214
Institutional Source Beutler Lab
Gene Symbol Ptchd3
Ensembl Gene ENSMUSG00000039198
Gene Namepatched domain containing 3
Synonyms4933440L20Rik, 4930451E13Rik
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121830247-121843423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121836431 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 377 (S377F)
Ref Sequence ENSEMBL: ENSMUSP00000035709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036690]
Predicted Effect probably damaging
Transcript: ENSMUST00000036690
AA Change: S377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035709
Gene: ENSMUSG00000039198
AA Change: S377F

DomainStartEndE-ValueType
Pfam:Patched 121 906 1.2e-177 PFAM
Pfam:Sterol-sensing 363 508 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125199
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Ttc3 T A 16: 94,466,877 probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Ptchd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ptchd3 APN 11 121831146 missense probably damaging 1.00
IGL01459:Ptchd3 APN 11 121830420 missense probably benign 0.00
IGL02815:Ptchd3 APN 11 121841604 missense probably benign 0.03
PIT4418001:Ptchd3 UTSW 11 121841740 nonsense probably null
PIT4791001:Ptchd3 UTSW 11 121832049 missense probably damaging 0.98
R0018:Ptchd3 UTSW 11 121842344 missense probably benign
R0068:Ptchd3 UTSW 11 121842972 missense probably damaging 1.00
R0068:Ptchd3 UTSW 11 121842972 missense probably damaging 1.00
R0316:Ptchd3 UTSW 11 121842090 missense possibly damaging 0.91
R0331:Ptchd3 UTSW 11 121842191 missense probably benign 0.00
R0715:Ptchd3 UTSW 11 121831158 missense possibly damaging 0.90
R1200:Ptchd3 UTSW 11 121831261 critical splice donor site probably null
R1595:Ptchd3 UTSW 11 121830594 missense probably damaging 1.00
R1763:Ptchd3 UTSW 11 121842542 missense probably benign 0.00
R1792:Ptchd3 UTSW 11 121841551 nonsense probably null
R2098:Ptchd3 UTSW 11 121842479 missense probably damaging 1.00
R4120:Ptchd3 UTSW 11 121830746 missense probably damaging 1.00
R4702:Ptchd3 UTSW 11 121836409 missense probably damaging 1.00
R4761:Ptchd3 UTSW 11 121836398 missense possibly damaging 0.95
R4868:Ptchd3 UTSW 11 121831057 missense possibly damaging 0.85
R4948:Ptchd3 UTSW 11 121842516 missense probably damaging 1.00
R5092:Ptchd3 UTSW 11 121831146 missense probably damaging 1.00
R5954:Ptchd3 UTSW 11 121836587 intron probably benign
R6199:Ptchd3 UTSW 11 121831082 missense probably benign 0.17
R6431:Ptchd3 UTSW 11 121836403 missense probably benign 0.06
R6484:Ptchd3 UTSW 11 121842938 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTTTTCATCCTCACATTTAGGGTC -3'
(R):5'- TATACTTTCTGTTGTTTGAGCCAGC -3'

Sequencing Primer
(F):5'- CACATTTAGGGTCCTCACCTG -3'
(R):5'- CTGTTGTTTGAGCCAGCTAAAC -3'
Posted On2015-08-18