Incidental Mutation 'R4533:Ttc3'
ID333218
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
MMRRC Submission 041773-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R4533 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 94466877 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000154196] [ENSMUST00000211314] [ENSMUST00000231569] [ENSMUST00000231915] [ENSMUST00000232395] [ENSMUST00000232660]
Predicted Effect probably benign
Transcript: ENSMUST00000117648
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131429
Predicted Effect probably benign
Transcript: ENSMUST00000154196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211314
Predicted Effect probably benign
Transcript: ENSMUST00000231569
Predicted Effect probably benign
Transcript: ENSMUST00000231915
Predicted Effect probably benign
Transcript: ENSMUST00000232368
Predicted Effect probably benign
Transcript: ENSMUST00000232395
Predicted Effect probably benign
Transcript: ENSMUST00000232660
Meta Mutation Damage Score 0.0416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,180,708 Y405C probably damaging Het
Ago3 A T 4: 126,345,563 S832T probably damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Anapc5 T C 5: 122,791,735 E561G possibly damaging Het
Art5 T C 7: 102,098,338 H78R probably benign Het
Blvra T A 2: 127,090,384 probably null Het
Ccdc171 A G 4: 83,657,342 T488A possibly damaging Het
Crtc3 A T 7: 80,589,795 M603K probably damaging Het
Csmd1 T C 8: 15,931,037 probably null Het
Dbh C A 2: 27,177,331 H409Q possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm7356 A C 17: 14,001,410 I119R probably damaging Het
Heatr1 T A 13: 12,434,511 D1963E probably benign Het
Ighv1-37 A T 12: 114,896,527 V21D probably damaging Het
Itga3 T G 11: 95,057,293 Q602P probably benign Het
Kcmf1 G A 6: 72,849,591 R152C probably damaging Het
Lin54 T C 5: 100,485,403 I141V possibly damaging Het
Mast1 T A 8: 84,921,361 H497L probably damaging Het
Mrpl44 T C 1: 79,776,254 F41S possibly damaging Het
Myo18b T C 5: 112,693,025 R2301G probably damaging Het
Nek1 A T 8: 61,007,213 M58L possibly damaging Het
Olfr726 T C 14: 50,083,699 probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
P3h3 A G 6: 124,854,408 V338A possibly damaging Het
Pcdha7 T C 18: 36,975,407 V495A possibly damaging Het
Plcb3 T C 19: 6,956,272 E895G probably benign Het
Plekha5 A G 6: 140,570,331 E770G probably damaging Het
Ptchd3 C T 11: 121,836,431 S377F probably damaging Het
Ptprj C T 2: 90,439,955 D1266N probably damaging Het
Raly A T 2: 154,865,933 E291V probably damaging Het
Rnf217 C A 10: 31,608,763 C141F possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a3 A G 8: 94,357,086 M914V probably null Het
Tbc1d9 A G 8: 83,270,918 T1035A probably damaging Het
Tex14 C T 11: 87,536,829 R36* probably null Het
Tiparp A G 3: 65,546,347 D172G probably benign Het
Uap1 A T 1: 170,143,425 I466N probably damaging Het
Ubr1 T C 2: 120,942,482 T426A possibly damaging Het
Vmn1r77 T A 7: 12,041,829 H177Q probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vwc2l G A 1: 70,882,139 C151Y probably damaging Het
Wdr12 T C 1: 60,078,195 Y414C probably benign Het
Zfp609 A C 9: 65,703,608 V691G probably benign Het
Zmiz1 T C 14: 25,645,660 Y254H probably damaging Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 unclassified probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGTTGAAACGGTTCCCTCTG -3'
(R):5'- TGTTTACAGTCACATGAACACATG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CCACATTTTAGCACACGC -3'
Posted On2015-08-18