Incidental Mutation 'R4536:C1qtnf3'
ID333342
Institutional Source Beutler Lab
Gene Symbol C1qtnf3
Ensembl Gene ENSMUSG00000058914
Gene NameC1q and tumor necrosis factor related protein 3
SynonymsCorcs, CTRP3, 2310005P21Rik, CORS-26
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10952332-10980150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10972027 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 206 (S206N)
Ref Sequence ENSEMBL: ENSMUSP00000106152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022853] [ENSMUST00000110523]
Predicted Effect probably benign
Transcript: ENSMUST00000022853
AA Change: S133N

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022853
Gene: ENSMUSG00000058914
AA Change: S133N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
C1Q 111 245 2.26e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110523
AA Change: S206N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106152
Gene: ENSMUSG00000058914
AA Change: S206N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
C1Q 184 318 2.26e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in C1qtnf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:C1qtnf3 APN 15 10960682 missense probably damaging 1.00
IGL02491:C1qtnf3 APN 15 10971981 missense possibly damaging 0.69
mimosa_pudica UTSW 15 10958070 critical splice donor site probably null
R0083:C1qtnf3 UTSW 15 10975632 missense possibly damaging 0.89
R1136:C1qtnf3 UTSW 15 10978584 missense probably damaging 0.98
R1447:C1qtnf3 UTSW 15 10952649 missense probably damaging 1.00
R1510:C1qtnf3 UTSW 15 10975636 missense probably benign 0.05
R5397:C1qtnf3 UTSW 15 10978541 missense probably damaging 0.99
R5833:C1qtnf3 UTSW 15 10975630 missense probably benign 0.06
R6483:C1qtnf3 UTSW 15 10958070 critical splice donor site probably null
R6555:C1qtnf3 UTSW 15 10975656 missense probably damaging 0.99
R7324:C1qtnf3 UTSW 15 10952621 missense probably benign 0.04
R7456:C1qtnf3 UTSW 15 10972051 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCAGAGCAATATCACACAGAATAG -3'
(R):5'- TGGAAGACTATATGAGCCGTTTG -3'

Sequencing Primer
(F):5'- ACTTACTTATTTGCCTATTGCTTGG -3'
(R):5'- GCCGTTTGCTTTCCTTCC -3'
Posted On2015-08-18