Incidental Mutation 'R4537:Olfr979'
ID333378
Institutional Source Beutler Lab
Gene Symbol Olfr979
Ensembl Gene ENSMUSG00000059473
Gene Nameolfactory receptor 979
SynonymsMOR223-1, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission 041774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4537 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39998003-40003465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40000320 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 302 (K302N)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably benign
Transcript: ENSMUST00000080835
AA Change: K302N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: K302N

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
AA Change: K302N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T A 13: 14,120,161 Y9* probably null Het
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Ighv14-2 A G 12: 113,994,892 C3R probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr681 T A 7: 105,127,020 I84F probably damaging Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olig2 A G 16: 91,226,844 I149V probably damaging Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Olfr979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr979 APN 9 40000886 missense probably damaging 1.00
IGL02939:Olfr979 APN 9 40000898 missense probably benign 0.26
IGL02991:Olfr979 UTSW 9 40000402 missense probably damaging 1.00
R1388:Olfr979 UTSW 9 40000652 missense probably damaging 0.99
R1572:Olfr979 UTSW 9 40001194 missense probably benign 0.35
R2089:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2179:Olfr979 UTSW 9 40000924 missense probably benign 0.44
R3424:Olfr979 UTSW 9 40000534 missense probably damaging 0.97
R3964:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R3965:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R4111:Olfr979 UTSW 9 40000898 nonsense probably null
R4737:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
R4926:Olfr979 UTSW 9 40001023 unclassified probably null
R5303:Olfr979 UTSW 9 40000588 missense probably damaging 1.00
R5587:Olfr979 UTSW 9 40000621 missense possibly damaging 0.90
R6387:Olfr979 UTSW 9 40000852 missense probably damaging 0.99
R6394:Olfr979 UTSW 9 40000705 missense probably benign 0.04
R6765:Olfr979 UTSW 9 40001197 missense probably damaging 1.00
R7312:Olfr979 UTSW 9 40000810 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CACATATGTCACATGTCAGAGATC -3'
(R):5'- AGGATTCGTACTTCAGAGGGC -3'

Sequencing Primer
(F):5'- ATTCCGGAGAAGCTGGAT -3'
(R):5'- AGAGCTTTCCAGACATGTGC -3'
Posted On2015-08-18