Incidental Mutation 'R0107:Utp20'
ID33338
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88778391 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1234 (T1234A)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: T1234A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: T1234A

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000219662
AA Change: T77A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220275
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAGCAGAAGCTGCCTACAATGTC -3'
(R):5'- ATGTGTGAGACTCCATCTCAGCCC -3'

Sequencing Primer
(F):5'- GCTGCCTACAATGTCTATGAATCAC -3'
(R):5'- TCTTACGACAGCTTGGTGC -3'
Posted On2013-05-09