Incidental Mutation 'R4537:Sost'
ID333387
Institutional Source Beutler Lab
Gene Symbol Sost
Ensembl Gene ENSMUSG00000001494
Gene Namesclerostin
Synonyms5430411E23Rik
MMRRC Submission 041774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4537 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101962458-101967015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101966844 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 44 (P44S)
Ref Sequence ENSEMBL: ENSMUSP00000001534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001534] [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000151678]
Predicted Effect probably damaging
Transcript: ENSMUST00000001534
AA Change: P44S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001534
Gene: ENSMUSG00000001494
AA Change: P44S

DomainStartEndE-ValueType
Pfam:Sclerostin 1 208 8e-98 PFAM
Pfam:DAN 51 168 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176599
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in trabecular and cortical bone volume, mineral density, and formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T A 13: 14,120,161 Y9* probably null Het
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Ighv14-2 A G 12: 113,994,892 C3R probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr681 T A 7: 105,127,020 I84F probably damaging Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olfr979 T A 9: 40,000,320 K302N probably benign Het
Olig2 A G 16: 91,226,844 I149V probably damaging Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Sost
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Sost APN 11 101966879 missense probably damaging 1.00
IGL02487:Sost APN 11 101966807 missense possibly damaging 0.64
IGL02967:Sost APN 11 101964258 missense possibly damaging 0.50
R0724:Sost UTSW 11 101966918 missense probably benign 0.04
R1873:Sost UTSW 11 101964243 missense probably damaging 1.00
R2182:Sost UTSW 11 101963850 missense probably damaging 1.00
R3429:Sost UTSW 11 101964039 missense probably damaging 1.00
R4428:Sost UTSW 11 101966844 missense probably damaging 0.97
R4430:Sost UTSW 11 101966844 missense probably damaging 0.97
R4464:Sost UTSW 11 101966844 missense probably damaging 0.97
R4539:Sost UTSW 11 101966844 missense probably damaging 0.97
R4540:Sost UTSW 11 101966844 missense probably damaging 0.97
R4541:Sost UTSW 11 101966844 missense probably damaging 0.97
R4542:Sost UTSW 11 101966844 missense probably damaging 0.97
R4710:Sost UTSW 11 101966844 missense probably damaging 0.97
R5125:Sost UTSW 11 101963941 missense probably damaging 1.00
R7297:Sost UTSW 11 101964103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGTGTCCCTGCCCTGATG -3'
(R):5'- CAACCGTATCTAGGCTGGAC -3'

Sequencing Primer
(F):5'- TGCCCTGATGTAGCAGAGG -3'
(R):5'- TATCTAGGCTGGACACTGGAGC -3'
Posted On2015-08-18