Incidental Mutation 'R4537:Arid4b'
ID333390
Institutional Source Beutler Lab
Gene Symbol Arid4b
Ensembl Gene ENSMUSG00000039219
Gene NameAT rich interactive domain 4B (RBP1-like)
Synonyms6720480E17Rik, RBBP1L1, Rbp1l1, BRCAA1, SAP180, 6330417L24Rik
MMRRC Submission 041774-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4537 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14063232-14199603 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 14120161 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 9 (Y9*)
Ref Sequence ENSEMBL: ENSMUSP00000152177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039538] [ENSMUST00000110533] [ENSMUST00000110534] [ENSMUST00000110536] [ENSMUST00000129488] [ENSMUST00000222928]
Predicted Effect probably null
Transcript: ENSMUST00000039538
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000043889
Gene: ENSMUSG00000039219
AA Change: Y9*

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104614
Predicted Effect probably null
Transcript: ENSMUST00000110533
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000106162
Gene: ENSMUSG00000039219
AA Change: Y9*

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 9.5e-48 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110534
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000106163
Gene: ENSMUSG00000039219
AA Change: Y9*

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 168 263 4.1e-39 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
TUDOR 567 632 1.91e1 SMART
CHROMO 585 640 1.29e-1 SMART
low complexity region 708 722 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
low complexity region 802 815 N/A INTRINSIC
low complexity region 856 872 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
low complexity region 1041 1051 N/A INTRINSIC
low complexity region 1089 1103 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
coiled coil region 1232 1269 N/A INTRINSIC
low complexity region 1273 1291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110536
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000106165
Gene: ENSMUSG00000039219
AA Change: Y9*

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129488
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000118687
Gene: ENSMUSG00000039219
AA Change: Y9*

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 1.8e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155553
Predicted Effect probably null
Transcript: ENSMUST00000222928
AA Change: Y9*
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die pre-implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,474,303 I1235T probably benign Het
Defb30 T C 14: 63,036,076 I29M probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dpy19l3 T C 7: 35,711,901 T428A probably benign Het
Fam83b T C 9: 76,492,142 T560A probably benign Het
Fnip2 A G 3: 79,465,714 V1019A probably damaging Het
Fus A G 7: 127,975,915 D268G probably damaging Het
Gm14412 T A 2: 177,314,559 K514N probably benign Het
Gphn T C 12: 78,494,014 L265P probably benign Het
Grm3 A G 5: 9,512,083 M589T probably benign Het
Hoxa1 G T 6: 52,157,993 Q77K probably benign Het
Ighv14-2 A G 12: 113,994,892 C3R probably benign Het
Itgb2 G A 10: 77,561,216 probably null Het
Mrpl24 A C 3: 87,922,412 K102Q probably benign Het
Ogfod2 C T 5: 124,114,528 probably benign Het
Olfr681 T A 7: 105,127,020 I84F probably damaging Het
Olfr832 T A 9: 18,945,230 I194N possibly damaging Het
Olfr979 T A 9: 40,000,320 K302N probably benign Het
Olig2 A G 16: 91,226,844 I149V probably damaging Het
Oxr1 A G 15: 41,820,519 Q515R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Slc25a12 T A 2: 71,275,106 probably benign Het
Slc2a3 C A 6: 122,737,104 G157V probably damaging Het
Slc5a4a C T 10: 76,178,095 R379* probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Srd5a3 G A 5: 76,149,951 probably null Het
Tmtc1 C T 6: 148,262,782 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn2r87 T G 10: 130,472,185 H728P probably benign Het
Vmn2r93 T A 17: 18,304,932 M284K possibly damaging Het
Zfp101 T A 17: 33,382,492 M59L possibly damaging Het
Zfp558 T C 9: 18,457,502 E146G probably null Het
Other mutations in Arid4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Arid4b APN 13 14191134 unclassified probably benign
IGL00581:Arid4b APN 13 14160195 missense probably damaging 1.00
IGL00808:Arid4b APN 13 14136261 critical splice donor site probably null
IGL01150:Arid4b APN 13 14195374 nonsense probably null
IGL01570:Arid4b APN 13 14186809 unclassified probably benign
IGL01942:Arid4b APN 13 14136164 intron probably benign
IGL02031:Arid4b APN 13 14153412 splice site probably benign
IGL02183:Arid4b APN 13 14169990 missense possibly damaging 0.68
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0514:Arid4b UTSW 13 14184317 missense probably damaging 1.00
R0694:Arid4b UTSW 13 14187834 missense probably damaging 0.96
R0746:Arid4b UTSW 13 14143038 missense probably benign 0.01
R1624:Arid4b UTSW 13 14184394 missense probably damaging 0.99
R1625:Arid4b UTSW 13 14187114 missense probably damaging 0.99
R1812:Arid4b UTSW 13 14195429 missense probably damaging 1.00
R1891:Arid4b UTSW 13 14136236 missense possibly damaging 0.94
R1990:Arid4b UTSW 13 14132436 missense probably damaging 0.99
R2051:Arid4b UTSW 13 14187645 missense probably damaging 0.98
R2060:Arid4b UTSW 13 14195452 missense probably damaging 1.00
R2344:Arid4b UTSW 13 14153490 missense probably benign 0.26
R3605:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3606:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3844:Arid4b UTSW 13 14187060 missense probably damaging 0.99
R3909:Arid4b UTSW 13 14132484 missense probably damaging 1.00
R3938:Arid4b UTSW 13 14186928 missense probably benign 0.34
R4394:Arid4b UTSW 13 14154972 splice site probably null
R4466:Arid4b UTSW 13 14132510 missense probably damaging 1.00
R4530:Arid4b UTSW 13 14126455 missense probably damaging 0.98
R4829:Arid4b UTSW 13 14184438 missense probably benign 0.23
R4930:Arid4b UTSW 13 14187477 missense probably damaging 0.99
R4972:Arid4b UTSW 13 14160272 missense probably benign 0.07
R5119:Arid4b UTSW 13 14164281 missense probably benign 0.15
R5236:Arid4b UTSW 13 14126449 critical splice acceptor site probably null
R5304:Arid4b UTSW 13 14186929 missense probably benign 0.34
R5439:Arid4b UTSW 13 14187696 missense probably damaging 0.99
R5734:Arid4b UTSW 13 14160271 missense probably benign 0.09
R5950:Arid4b UTSW 13 14191264 splice site probably benign
R5951:Arid4b UTSW 13 14143063 missense possibly damaging 0.80
R6645:Arid4b UTSW 13 14120152 missense probably damaging 1.00
R6765:Arid4b UTSW 13 14187315 missense possibly damaging 0.84
R6804:Arid4b UTSW 13 14129207 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCGATCTTAGGGGCCATATGTG -3'
(R):5'- TATGGGCAACTTTTGGGATAGC -3'

Sequencing Primer
(F):5'- CTTAGGGGCCATATGTGTTTAATAG -3'
(R):5'- CAACTTTTGGGATAGCTTTGGAAATG -3'
Posted On2015-08-18