Incidental Mutation 'R4538:Slc5a4a'
ID333416
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Namesolute carrier family 5, member 4a
Synonyms
MMRRC Submission 041775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R4538 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76147451-76189265 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 76178095 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 379 (R379*)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
Predicted Effect probably null
Transcript: ENSMUST00000020450
AA Change: R379*
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: R379*

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,488,837 V61M unknown Het
Abcc9 A G 6: 142,614,412 probably null Het
Adcy10 A T 1: 165,513,127 M234L probably benign Het
B4galt3 T C 1: 171,272,710 F150S probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Chd4 A T 6: 125,120,686 D1377V probably damaging Het
Cope T A 8: 70,306,507 I16N probably damaging Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cyp7b1 A T 3: 18,097,581 I156N possibly damaging Het
Depdc5 T C 5: 32,983,946 Y1397H probably damaging Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Ebf1 T A 11: 44,907,995 D289E probably benign Het
Egflam T C 15: 7,252,437 Y406C probably damaging Het
Hfm1 T C 5: 106,874,890 T949A possibly damaging Het
Ifih1 A G 2: 62,617,412 V316A probably damaging Het
Kif1a C T 1: 93,077,047 V142M probably damaging Het
Kng2 C A 16: 22,988,063 R462L probably benign Het
Lrrn1 T A 6: 107,568,637 N465K probably benign Het
Mdn1 T A 4: 32,722,334 L2372Q probably damaging Het
Men1 T C 19: 6,336,754 F159L possibly damaging Het
Mul1 T C 4: 138,438,395 probably benign Het
Olfr168 A T 16: 19,530,631 C96* probably null Het
Pramel6 T G 2: 87,508,559 H34Q probably benign Het
Ripk4 A T 16: 97,743,152 L702* probably null Het
Slc9a3 T C 13: 74,161,732 V513A possibly damaging Het
Strada A C 11: 106,167,825 M245R probably damaging Het
Sycp1 A T 3: 102,840,962 I838K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trbv17 A C 6: 41,163,352 N47T probably benign Het
Washc3 T A 10: 88,216,009 S87T probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 unclassified probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGATCACCAGGAGTTACACAG -3'
(R):5'- ATGCAAACTCTAGTCTGCCTC -3'

Sequencing Primer
(F):5'- AGGAAGCTCCACCTGCATTTC -3'
(R):5'- CCTTCCTCAGAGGGGTTCTAG -3'
Posted On2015-08-18