Incidental Mutation 'R4540:Sost'
ID333503
Institutional Source Beutler Lab
Gene Symbol Sost
Ensembl Gene ENSMUSG00000001494
Gene Namesclerostin
Synonyms5430411E23Rik
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101962458-101967015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101966844 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 44 (P44S)
Ref Sequence ENSEMBL: ENSMUSP00000001534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001534] [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000151678]
Predicted Effect probably damaging
Transcript: ENSMUST00000001534
AA Change: P44S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001534
Gene: ENSMUSG00000001494
AA Change: P44S

DomainStartEndE-ValueType
Pfam:Sclerostin 1 208 8e-98 PFAM
Pfam:DAN 51 168 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176599
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in trabecular and cortical bone volume, mineral density, and formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Sost
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Sost APN 11 101966879 missense probably damaging 1.00
IGL02487:Sost APN 11 101966807 missense possibly damaging 0.64
IGL02967:Sost APN 11 101964258 missense possibly damaging 0.50
R0724:Sost UTSW 11 101966918 missense probably benign 0.04
R1873:Sost UTSW 11 101964243 missense probably damaging 1.00
R2182:Sost UTSW 11 101963850 missense probably damaging 1.00
R3429:Sost UTSW 11 101964039 missense probably damaging 1.00
R4428:Sost UTSW 11 101966844 missense probably damaging 0.97
R4430:Sost UTSW 11 101966844 missense probably damaging 0.97
R4464:Sost UTSW 11 101966844 missense probably damaging 0.97
R4537:Sost UTSW 11 101966844 missense probably damaging 0.97
R4539:Sost UTSW 11 101966844 missense probably damaging 0.97
R4541:Sost UTSW 11 101966844 missense probably damaging 0.97
R4542:Sost UTSW 11 101966844 missense probably damaging 0.97
R4710:Sost UTSW 11 101966844 missense probably damaging 0.97
R5125:Sost UTSW 11 101963941 missense probably damaging 1.00
R7297:Sost UTSW 11 101964103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGTCCCTGCCCTGATG -3'
(R):5'- AACCGTATCTAGGCTGGACAC -3'

Sequencing Primer
(F):5'- TGCCCTGATGTAGCAGAGG -3'
(R):5'- TATCTAGGCTGGACACTGGAGC -3'
Posted On2015-08-18