Incidental Mutation 'R4541:Prkcq'
ID 333519
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Name protein kinase C, theta
Synonyms A130035A12Rik, PKC-theta, PKC theta, PKC-0, Pkcq, PKCtheta
MMRRC Submission 041777-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4541 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 11176922-11306033 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11288623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 525 (M525I)
Ref Sequence ENSEMBL: ENSMUSP00000028118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
AlphaFold Q02111
PDB Structure Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028118
AA Change: M525I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: M525I

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102970
AA Change: M525I

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: M525I

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195628
Meta Mutation Damage Score 0.2774 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,769,676 (GRCm39) P73S probably benign Het
4930533L02Rik G A 7: 124,917,750 (GRCm39) noncoding transcript Het
Acot4 A T 12: 84,090,022 (GRCm39) I240F probably benign Het
B4galt6 A G 18: 20,878,496 (GRCm39) V10A probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Ccnb3 T C X: 6,875,308 (GRCm39) T424A probably benign Het
Cd8a A T 6: 71,350,856 (GRCm39) D107V probably benign Het
Cdca7l T C 12: 117,836,098 (GRCm39) S190P probably damaging Het
Ceacam12 G A 7: 17,805,648 (GRCm39) M278I probably benign Het
Cfap43 C T 19: 47,736,454 (GRCm39) V1346I probably benign Het
Clic5 C T 17: 44,552,956 (GRCm39) T70M probably damaging Het
Dbpht2 A T 12: 74,345,934 (GRCm39) noncoding transcript Het
Ddhd1 G A 14: 45,860,313 (GRCm39) R140* probably null Het
Evpl T G 11: 116,123,470 (GRCm39) I301L probably benign Het
Glul T A 1: 153,778,782 (GRCm39) Y30* probably null Het
Itgad A T 7: 127,797,287 (GRCm39) H878L probably benign Het
Kcnk10 A G 12: 98,402,536 (GRCm39) I301T probably damaging Het
Klhl14 A T 18: 21,687,696 (GRCm39) Y575* probably null Het
Mrps2 G T 2: 28,358,412 (GRCm39) probably benign Het
Mymx GCC GC 17: 45,912,519 (GRCm39) probably null Het
Napb G A 2: 148,551,229 (GRCm39) probably benign Het
Nlrp1c-ps A G 11: 71,171,706 (GRCm39) noncoding transcript Het
Or10g9b A C 9: 39,917,589 (GRCm39) S219A possibly damaging Het
Or4f15 A G 2: 111,813,981 (GRCm39) I146T probably benign Het
Piwil4 C A 9: 14,629,612 (GRCm39) M438I probably damaging Het
Pla2r1 C T 2: 60,258,082 (GRCm39) D1199N probably damaging Het
Pmpca T G 2: 26,280,201 (GRCm39) probably benign Het
Rnf225 T C 7: 12,662,520 (GRCm39) probably null Het
Sco1 G T 11: 66,943,668 (GRCm39) A50S probably benign Het
Slc12a2 T A 18: 58,046,037 (GRCm39) probably null Het
Slc36a1 T C 11: 55,112,849 (GRCm39) V148A probably benign Het
Sost G A 11: 101,857,670 (GRCm39) P44S probably damaging Het
Tbc1d10c G T 19: 4,239,473 (GRCm39) R96S probably damaging Het
Tbc1d2b A T 9: 90,087,222 (GRCm39) I919N probably damaging Het
Tcea1 T C 1: 4,963,659 (GRCm39) L233P probably damaging Het
Tlcd4 A G 3: 121,028,884 (GRCm39) M1T probably null Het
Tmem231 T C 8: 112,641,224 (GRCm39) T223A probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tomm34 A G 2: 163,896,719 (GRCm39) Y243H probably benign Het
Tubgcp4 A T 2: 121,025,907 (GRCm39) N584I probably benign Het
Vldlr T C 19: 27,216,192 (GRCm39) C7R probably damaging Het
Vmn1r42 A T 6: 89,822,533 (GRCm39) M12K probably benign Het
Vsig10 C T 5: 117,490,881 (GRCm39) probably benign Het
Zfp974 C G 7: 27,625,829 (GRCm39) V14L probably damaging Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11,288,654 (GRCm39) missense probably damaging 1.00
IGL01656:Prkcq APN 2 11,231,766 (GRCm39) missense probably damaging 1.00
IGL01732:Prkcq APN 2 11,265,644 (GRCm39) splice site probably benign
IGL02136:Prkcq APN 2 11,265,479 (GRCm39) missense probably benign 0.00
IGL02161:Prkcq APN 2 11,281,887 (GRCm39) missense probably benign
IGL02178:Prkcq APN 2 11,281,851 (GRCm39) missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11,265,597 (GRCm39) missense probably damaging 1.00
IGL03149:Prkcq APN 2 11,237,356 (GRCm39) missense probably benign 0.11
banks UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
celina UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
celina2 UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
Megabytes UTSW 2 11,295,262 (GRCm39) nonsense probably null
Monmouth UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
3-1:Prkcq UTSW 2 11,304,905 (GRCm39) missense probably damaging 1.00
K3955:Prkcq UTSW 2 11,251,604 (GRCm39) splice site probably benign
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0183:Prkcq UTSW 2 11,257,973 (GRCm39) missense probably damaging 1.00
R0366:Prkcq UTSW 2 11,251,649 (GRCm39) splice site probably benign
R0388:Prkcq UTSW 2 11,259,045 (GRCm39) missense probably benign
R1385:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R1687:Prkcq UTSW 2 11,295,344 (GRCm39) missense probably damaging 1.00
R1693:Prkcq UTSW 2 11,259,010 (GRCm39) missense probably damaging 0.99
R1760:Prkcq UTSW 2 11,304,881 (GRCm39) missense probably damaging 1.00
R1764:Prkcq UTSW 2 11,237,442 (GRCm39) missense probably damaging 1.00
R1968:Prkcq UTSW 2 11,250,208 (GRCm39) missense probably damaging 1.00
R2020:Prkcq UTSW 2 11,284,332 (GRCm39) missense probably benign
R2108:Prkcq UTSW 2 11,237,380 (GRCm39) missense probably damaging 1.00
R2762:Prkcq UTSW 2 11,237,451 (GRCm39) missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11,251,781 (GRCm39) missense probably damaging 1.00
R3545:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3547:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3893:Prkcq UTSW 2 11,231,782 (GRCm39) missense probably damaging 1.00
R4086:Prkcq UTSW 2 11,288,679 (GRCm39) missense probably damaging 0.97
R4423:Prkcq UTSW 2 11,260,980 (GRCm39) missense possibly damaging 0.66
R4649:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
R5197:Prkcq UTSW 2 11,304,227 (GRCm39) missense probably damaging 1.00
R6008:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R7030:Prkcq UTSW 2 11,231,661 (GRCm39) splice site probably null
R7231:Prkcq UTSW 2 11,295,262 (GRCm39) nonsense probably null
R7461:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R7613:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R8441:Prkcq UTSW 2 11,253,037 (GRCm39) missense probably benign 0.11
R8491:Prkcq UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
R8724:Prkcq UTSW 2 11,304,784 (GRCm39) missense probably benign 0.17
R9031:Prkcq UTSW 2 11,251,819 (GRCm39) missense probably damaging 0.99
R9164:Prkcq UTSW 2 11,231,716 (GRCm39) missense probably damaging 0.96
R9621:Prkcq UTSW 2 11,261,014 (GRCm39) missense probably benign 0.00
R9661:Prkcq UTSW 2 11,250,141 (GRCm39) nonsense probably null
Z1177:Prkcq UTSW 2 11,304,192 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGAACAGCCATTCGTGGTCAG -3'
(R):5'- CCCATTTGTGTGTCTGCAAC -3'

Sequencing Primer
(F):5'- ATTCGTGGTCAGCCCTCTG -3'
(R):5'- GTGTGTCTGCAACTGGAAAATACTCC -3'
Posted On 2015-08-18