Incidental Mutation 'R4541:Acot4'
ID333547
Institutional Source Beutler Lab
Gene Symbol Acot4
Ensembl Gene ENSMUSG00000052392
Gene Nameacyl-CoA thioesterase 4
SynonymsB430212I04Rik, Pte2b, PTE-Ib
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R4541 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84038379-84048601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84043248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 240 (I240F)
Ref Sequence ENSEMBL: ENSMUSP00000021652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021652]
Predicted Effect probably benign
Transcript: ENSMUST00000021652
AA Change: I240F

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021652
Gene: ENSMUSG00000052392
AA Change: I240F

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 3.4e-43 PFAM
low complexity region 148 159 N/A INTRINSIC
Pfam:Abhydrolase_5 162 361 1e-6 PFAM
Pfam:FSH1 193 364 3.5e-5 PFAM
Pfam:BAAT_C 203 412 1.1e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180751
Predicted Effect probably benign
Transcript: ENSMUST00000221229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221860
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Clic5 C T 17: 44,242,069 T70M probably damaging Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Kcnk10 A G 12: 98,436,277 I301T probably damaging Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Nlrp1c-ps A G 11: 71,280,880 noncoding transcript Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Piwil4 C A 9: 14,718,316 M438I probably damaging Het
Pla2r1 C T 2: 60,427,738 D1199N probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Acot4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Acot4 APN 12 84042025 missense probably damaging 0.98
IGL02806:Acot4 APN 12 84041963 missense probably damaging 1.00
IGL02967:Acot4 APN 12 84043461 missense probably benign
R1827:Acot4 UTSW 12 84041938 missense probably damaging 1.00
R2105:Acot4 UTSW 12 84038742 missense probably damaging 1.00
R2509:Acot4 UTSW 12 84041873 missense probably damaging 1.00
R2904:Acot4 UTSW 12 84043603 missense probably benign 0.31
R3859:Acot4 UTSW 12 84043444 missense probably benign 0.17
R3904:Acot4 UTSW 12 84043327 unclassified probably null
R4190:Acot4 UTSW 12 84043174 intron probably benign
R4192:Acot4 UTSW 12 84043174 intron probably benign
R5061:Acot4 UTSW 12 84038701 missense probably benign 0.03
R5682:Acot4 UTSW 12 84038802 missense probably damaging 1.00
R5864:Acot4 UTSW 12 84043404 missense probably benign 0.04
R6818:Acot4 UTSW 12 84042009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCTTTGGTGCTCGGTAAC -3'
(R):5'- CATTCCGTATATCCACAATGTCCAG -3'

Sequencing Primer
(F):5'- GGACAACTTGCAAGAGTCAGTTCTC -3'
(R):5'- GTATATCCACAATGTCCAGAATGC -3'
Posted On2015-08-18