Incidental Mutation 'R4541:Clic5'
ID333553
Institutional Source Beutler Lab
Gene Symbol Clic5
Ensembl Gene ENSMUSG00000023959
Gene Namechloride intracellular channel 5
Synonyms5730531E12Rik
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4541 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location44188572-44280168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44242069 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 70 (T70M)
Ref Sequence ENSEMBL: ENSMUSP00000024755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024755]
Predicted Effect probably damaging
Transcript: ENSMUST00000024755
AA Change: T70M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024755
Gene: ENSMUSG00000023959
AA Change: T70M

DomainStartEndE-ValueType
Pfam:GST_N_3 28 100 2.4e-10 PFAM
Pfam:GST_C_2 90 220 1e-9 PFAM
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit head bobbing and circling behavior, inability to swim, and complete deafness by 7-8 months of age caused by dysmorphic stereocilia and progressive hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
Acot4 A T 12: 84,043,248 I240F probably benign Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Kcnk10 A G 12: 98,436,277 I301T probably damaging Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Nlrp1c-ps A G 11: 71,280,880 noncoding transcript Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Piwil4 C A 9: 14,718,316 M438I probably damaging Het
Pla2r1 C T 2: 60,427,738 D1199N probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Clic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Clic5 APN 17 44248746 missense probably benign 0.00
IGL03196:Clic5 APN 17 44242073 missense possibly damaging 0.59
IGL03394:Clic5 APN 17 44237218 missense probably benign 0.19
R0035:Clic5 UTSW 17 44275313 missense probably damaging 1.00
R0035:Clic5 UTSW 17 44275313 missense probably damaging 1.00
R0375:Clic5 UTSW 17 44270623 missense possibly damaging 0.65
R2909:Clic5 UTSW 17 44275259 missense probably benign 0.00
R7101:Clic5 UTSW 17 44275292 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATGAGTTTTCGGTTTCACAC -3'
(R):5'- TGCACCCACTCTGAGATTGG -3'

Sequencing Primer
(F):5'- GGTTTCACACCACAGGCC -3'
(R):5'- GAGATTGGCATTCCATTTTGCTAACC -3'
Posted On2015-08-18