Incidental Mutation 'R4542:Cxcr2'
ID333563
Institutional Source Beutler Lab
Gene Symbol Cxcr2
Ensembl Gene ENSMUSG00000026180
Gene Namechemokine (C-X-C motif) receptor 2
SynonymsCD128, IL-8rb, Cmkar2, IL8RA, Il8rb, IL-8Rh, Gpcr16
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74153989-74161246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74158529 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 61 (S61G)
Ref Sequence ENSEMBL: ENSMUSP00000102512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]
Predicted Effect probably benign
Transcript: ENSMUST00000027372
AA Change: S61G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: S61G

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.2e-53 PFAM
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106899
AA Change: S61G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: S61G

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.1e-58 PFAM
low complexity region 346 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Cxcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02128:Cxcr2 APN 1 74158994 missense probably benign 0.07
IGL03384:Cxcr2 APN 1 74158791 missense probably damaging 0.98
copperas UTSW 1 74158460 missense probably damaging 0.98
R0780:Cxcr2 UTSW 1 74159175 missense probably damaging 0.97
R1178:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1180:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1448:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1535:Cxcr2 UTSW 1 74159058 missense probably damaging 1.00
R1851:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R1852:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R2897:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R2898:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R4430:Cxcr2 UTSW 1 74158845 missense probably benign 0.01
R5625:Cxcr2 UTSW 1 74158832 nonsense probably null
R5996:Cxcr2 UTSW 1 74158460 missense probably damaging 0.98
R6737:Cxcr2 UTSW 1 74158631 missense probably benign
R7206:Cxcr2 UTSW 1 74159054 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCCGTGCAATAACCTTCATC -3'
(R):5'- GGGTTGAGCCAAAAGTCCATC -3'

Sequencing Primer
(F):5'- TCTCTCCTCTATTGACAGGATTAAG -3'
(R):5'- GTTGAGCCAAAAGTCCATCCATTTAC -3'
Posted On2015-08-18