Incidental Mutation 'R4542:Stau1'
ID 333566
Institutional Source Beutler Lab
Gene Symbol Stau1
Ensembl Gene ENSMUSG00000039536
Gene Name staufen double-stranded RNA binding protein 1
Synonyms 5830401L18Rik
MMRRC Submission 041593-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4542 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166789469-166838219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166795181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 223 (Y223H)
Ref Sequence ENSEMBL: ENSMUSP00000139039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000184390]
AlphaFold Q9Z108
Predicted Effect probably damaging
Transcript: ENSMUST00000049412
AA Change: Y217H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536
AA Change: Y217H

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109235
AA Change: Y217H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536
AA Change: Y217H

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109236
AA Change: Y215H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536
AA Change: Y215H

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109238
AA Change: Y223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536
AA Change: Y223H

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154506
Predicted Effect probably damaging
Transcript: ENSMUST00000184390
AA Change: Y223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536
AA Change: Y223H

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149454
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit hypoactivity and impaired dendrite outgrowth and spine formation. [provided by MGI curators]
Allele List at MGI

All alleles(55) : Targeted, other(1) Gene trapped(54)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,163,875 (GRCm39) L833Q probably damaging Het
Adcy6 C G 15: 98,496,869 (GRCm39) V469L possibly damaging Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bean1 T A 8: 104,937,591 (GRCm39) F57I probably damaging Het
Brinp1 T C 4: 68,680,329 (GRCm39) I734V probably benign Het
Cab39l C A 14: 59,734,351 (GRCm39) D23E probably benign Het
Cfap54 T C 10: 92,860,991 (GRCm39) T839A probably benign Het
Clgn A G 8: 84,146,838 (GRCm39) E297G probably damaging Het
Crip1 A G 12: 113,117,109 (GRCm39) Y108C probably damaging Het
Cxcr2 A G 1: 74,197,688 (GRCm39) S61G probably benign Het
Dph5 T C 3: 115,722,274 (GRCm39) S251P probably damaging Het
E2f7 T A 10: 110,602,984 (GRCm39) V333E probably damaging Het
Eif4g3 A G 4: 137,930,728 (GRCm39) D918G probably damaging Het
Epn1 A G 7: 5,096,980 (GRCm39) E254G possibly damaging Het
Fat1 T C 8: 45,494,931 (GRCm39) C4065R probably damaging Het
Gja1 T C 10: 56,264,148 (GRCm39) F169S probably damaging Het
Kmt2b A G 7: 30,279,684 (GRCm39) I1384T probably damaging Het
Ltbp2 A T 12: 84,878,593 (GRCm39) L302* probably null Het
Nalcn T C 14: 123,558,889 (GRCm39) silent Het
Nlrp1b A C 11: 71,119,151 (GRCm39) L48W probably damaging Het
Nlrp4c G A 7: 6,103,826 (GRCm39) W920* probably null Het
Nr2f1 C T 13: 78,337,940 (GRCm39) G235D probably damaging Het
Nt5dc2 T A 14: 30,860,095 (GRCm39) D374E probably benign Het
Or2d3 GAACAACAACAA GAACAACAA 7: 106,490,567 (GRCm39) probably benign Het
Or51e2 T C 7: 102,391,850 (GRCm39) D120G probably damaging Het
Or5ak23 T C 2: 85,244,287 (GRCm39) D312G probably benign Het
Pikfyve T C 1: 65,283,589 (GRCm39) I742T probably damaging Het
Rftn1 A G 17: 50,362,259 (GRCm39) probably null Het
Rfx1 G A 8: 84,816,866 (GRCm39) G466S probably damaging Het
Scn11a A T 9: 119,584,200 (GRCm39) S1472T probably damaging Het
Sh2d4a A G 8: 68,799,394 (GRCm39) Q421R probably benign Het
Slc25a10 G A 11: 120,388,807 (GRCm39) probably null Het
Sost G A 11: 101,857,670 (GRCm39) P44S probably damaging Het
Spen T C 4: 141,204,097 (GRCm39) Y1510C unknown Het
Ssu72 A G 4: 155,817,934 (GRCm39) Q163R probably benign Het
Syne3 A T 12: 104,935,503 (GRCm39) S92T probably benign Het
Ulbp1 T C 10: 7,406,570 (GRCm39) D45G probably damaging Het
Ulk4 G A 9: 121,092,704 (GRCm39) R178* probably null Het
Vmn1r67 A G 7: 10,181,357 (GRCm39) Y207C probably damaging Het
Vmn2r59 T C 7: 41,695,497 (GRCm39) D305G possibly damaging Het
Zbtb18 A G 1: 177,276,232 (GRCm39) K522E probably damaging Het
Other mutations in Stau1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Stau1 APN 2 166,792,729 (GRCm39) missense probably benign 0.03
IGL00531:Stau1 APN 2 166,806,542 (GRCm39) missense probably benign 0.00
IGL00553:Stau1 APN 2 166,793,254 (GRCm39) missense possibly damaging 0.88
IGL02311:Stau1 APN 2 166,792,239 (GRCm39) missense probably damaging 1.00
IGL02558:Stau1 APN 2 166,792,768 (GRCm39) missense probably benign 0.10
IGL02746:Stau1 APN 2 166,796,818 (GRCm39) critical splice donor site probably null
IGL02797:Stau1 APN 2 166,791,266 (GRCm39) makesense probably null
IGL03308:Stau1 APN 2 166,792,240 (GRCm39) missense probably damaging 1.00
D4216:Stau1 UTSW 2 166,791,670 (GRCm39) missense probably benign
R0614:Stau1 UTSW 2 166,792,726 (GRCm39) missense probably damaging 1.00
R1036:Stau1 UTSW 2 166,793,235 (GRCm39) missense probably damaging 0.96
R2935:Stau1 UTSW 2 166,797,037 (GRCm39) missense probably benign 0.00
R3078:Stau1 UTSW 2 166,796,936 (GRCm39) missense possibly damaging 0.68
R4778:Stau1 UTSW 2 166,805,442 (GRCm39) missense probably benign 0.00
R6397:Stau1 UTSW 2 166,792,927 (GRCm39) missense possibly damaging 0.83
R7208:Stau1 UTSW 2 166,805,494 (GRCm39) missense probably damaging 0.98
R7870:Stau1 UTSW 2 166,792,870 (GRCm39) missense possibly damaging 0.89
R7877:Stau1 UTSW 2 166,792,787 (GRCm39) missense possibly damaging 0.95
R8844:Stau1 UTSW 2 166,793,266 (GRCm39) missense probably benign 0.00
R9174:Stau1 UTSW 2 166,791,269 (GRCm39) missense probably damaging 0.99
R9353:Stau1 UTSW 2 166,792,267 (GRCm39) missense probably damaging 1.00
R9410:Stau1 UTSW 2 166,797,038 (GRCm39) missense probably benign
R9784:Stau1 UTSW 2 166,791,695 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGCAAACTCTGGTCCAAC -3'
(R):5'- AGGTTTCTGTCTCAGTCCCG -3'

Sequencing Primer
(F):5'- GTCTTGAACTCATAGAGATCCACCTG -3'
(R):5'- GTCTCAGTCCCGTGCTGAC -3'
Posted On 2015-08-18