Incidental Mutation 'R4542:Dph5'
ID333568
Institutional Source Beutler Lab
Gene Symbol Dph5
Ensembl Gene ENSMUSG00000033554
Gene Namediphthamide biosynthesis 5
Synonyms2410012M04Rik
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.801) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location115887837-115934361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115928625 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000140958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043342] [ENSMUST00000185098] [ENSMUST00000189799]
Predicted Effect probably damaging
Transcript: ENSMUST00000043342
AA Change: S251P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043730
Gene: ENSMUSG00000033554
AA Change: S251P

DomainStartEndE-ValueType
Pfam:TP_methylase 1 241 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185098
SMART Domains Protein: ENSMUSP00000139249
Gene: ENSMUSG00000033554

DomainStartEndE-ValueType
Pfam:TP_methylase 1 177 4.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189799
AA Change: S251P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140958
Gene: ENSMUSG00000033554
AA Change: S251P

DomainStartEndE-ValueType
Pfam:TP_methylase 1 241 7.7e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the diphthamide synthesis pathway. Diphthamide is a post-translationally modified histidine residue found only on translation elongation factor 2. It is conserved from archaebacteria to humans, and is targeted by diphtheria toxin and Pseudomonas exotoxin A to halt cellular protein synthesis. The yeast and Chinese hamster homologs of this protein catalyze the trimethylation of the histidine residue on elongation factor 2, resulting in a diphthine moiety that is subsequently amidated to yield diphthamide. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Dph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Dph5 APN 3 115899713 missense probably damaging 1.00
IGL02441:Dph5 APN 3 115926741 missense possibly damaging 0.88
IGL02852:Dph5 APN 3 115928671 missense possibly damaging 0.95
R0200:Dph5 UTSW 3 115928703 missense probably benign 0.03
R0463:Dph5 UTSW 3 115928703 missense probably benign 0.03
R0466:Dph5 UTSW 3 115928710 missense probably benign 0.02
R0707:Dph5 UTSW 3 115915133 missense probably benign 0.00
R4601:Dph5 UTSW 3 115899777 missense possibly damaging 0.93
R4932:Dph5 UTSW 3 115899807 missense probably benign
R4950:Dph5 UTSW 3 115928643 missense probably benign 0.33
R6504:Dph5 UTSW 3 115926803 splice site probably null
R6662:Dph5 UTSW 3 115928556 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGAAGTCAGTGTGTGCAC -3'
(R):5'- GACAGAGCCATGCCATTTGAC -3'

Sequencing Primer
(F):5'- GCACTGTTACTGTGAAAGTTGAC -3'
(R):5'- GCCATGCCATTTGACATATAAATACC -3'
Posted On2015-08-18