Incidental Mutation 'R4542:Ssu72'
ID333572
Institutional Source Beutler Lab
Gene Symbol Ssu72
Ensembl Gene ENSMUSG00000029038
Gene NameSsu72 RNA polymerase II CTD phosphatase homolog (yeast)
Synonyms
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155704800-155733879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155733477 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 163 (Q163R)
Ref Sequence ENSEMBL: ENSMUSP00000030905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030905] [ENSMUST00000105595] [ENSMUST00000127188] [ENSMUST00000147721]
Predicted Effect probably benign
Transcript: ENSMUST00000030905
AA Change: Q163R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030905
Gene: ENSMUSG00000029038
AA Change: Q163R

DomainStartEndE-ValueType
Pfam:Ssu72 6 194 1.3e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105595
SMART Domains Protein: ENSMUSP00000101220
Gene: ENSMUSG00000029038

DomainStartEndE-ValueType
Pfam:Ssu72 4 176 2.8e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127188
SMART Domains Protein: ENSMUSP00000127341
Gene: ENSMUSG00000084845

DomainStartEndE-ValueType
Pfam:TMEM240 1 173 3.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147721
SMART Domains Protein: ENSMUSP00000130974
Gene: ENSMUSG00000084845

DomainStartEndE-ValueType
Pfam:TMEM240 1 173 1.5e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178987
SMART Domains Protein: ENSMUSP00000136958
Gene: ENSMUSG00000096221

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197451
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Ssu72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Ssu72 APN 4 155732026 missense probably benign 0.37
IGL02601:Ssu72 APN 4 155705425 missense possibly damaging 0.90
R1575:Ssu72 UTSW 4 155731357 missense probably benign 0.03
R2145:Ssu72 UTSW 4 155705443 missense probably damaging 0.98
R2517:Ssu72 UTSW 4 155733513 missense probably damaging 1.00
R3935:Ssu72 UTSW 4 155705419 missense probably benign 0.28
R4851:Ssu72 UTSW 4 155715596 missense possibly damaging 0.51
R5419:Ssu72 UTSW 4 155715550 missense probably damaging 1.00
R6524:Ssu72 UTSW 4 155715540 missense probably null 1.00
R7146:Ssu72 UTSW 4 155731393 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGAATCTAGCCGTCCCAC -3'
(R):5'- ACATTGATGATGTACACCTAGCAG -3'

Sequencing Primer
(F):5'- GCCGTCCCACTCCCAATATGG -3'
(R):5'- GATGATGTACACCTAGCAGTAAAAAC -3'
Posted On2015-08-18