Incidental Mutation 'R4542:Bean1'
ID333585
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Namebrain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104170442-104219122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104210959 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 57 (F57I)
Ref Sequence ENSEMBL: ENSMUSP00000148571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
Predicted Effect probably damaging
Transcript: ENSMUST00000093245
AA Change: F23I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: F23I

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164076
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167633
AA Change: F23I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: F23I

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171018
AA Change: F57I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: F57I

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212979
AA Change: F57I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000213077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104210918 missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104217175 missense probably damaging 1.00
R0490:Bean1 UTSW 8 104215028 missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104217224 missense probably benign
R1920:Bean1 UTSW 8 104211110 missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104182011 missense probably benign 0.04
R3980:Bean1 UTSW 8 104211098 missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104213934 start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104217110 missense probably damaging 1.00
R4516:Bean1 UTSW 8 104215154 missense probably damaging 1.00
R4663:Bean1 UTSW 8 104211167 missense probably damaging 1.00
R4962:Bean1 UTSW 8 104216974 missense probably damaging 1.00
R5221:Bean1 UTSW 8 104215152 missense probably damaging 1.00
R6288:Bean1 UTSW 8 104210990 missense probably damaging 1.00
R6588:Bean1 UTSW 8 104182032 frame shift probably null
R6615:Bean1 UTSW 8 104182032 frame shift probably null
R6994:Bean1 UTSW 8 104182032 frame shift probably null
R7359:Bean1 UTSW 8 104182032 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAACAAAAGCCTGACCCTG -3'
(R):5'- AAGTAGCATGACTCAGAGCTCAC -3'

Sequencing Primer
(F):5'- TGACTATCCTCCACTTATTTAGAGAC -3'
(R):5'- ATGACTCAGAGCTCACCGTATTC -3'
Posted On2015-08-18