Incidental Mutation 'R4542:Ulbp1'
ID333590
Institutional Source Beutler Lab
Gene Symbol Ulbp1
Ensembl Gene ENSMUSG00000079685
Gene NameUL16 binding protein 1
SynonymsA430108B07Rik, MULT1
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location7440362-7473638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7456570 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000151680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169796] [ENSMUST00000177585] [ENSMUST00000218087]
Predicted Effect probably benign
Transcript: ENSMUST00000169796
AA Change: D130G

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128204
Gene: ENSMUSG00000079685
AA Change: D130G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PDB:1KCG|C 31 119 2e-7 PDB
transmembrane domain 124 146 N/A INTRINSIC
internal_repeat_1 148 174 1.72e-7 PROSPERO
internal_repeat_1 193 219 1.72e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000177585
AA Change: D130G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136637
Gene: ENSMUSG00000079685
AA Change: D130G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PDB:1KCG|C 46 204 7e-10 PDB
transmembrane domain 209 231 N/A INTRINSIC
internal_repeat_1 233 259 5.4e-7 PROSPERO
internal_repeat_1 278 304 5.4e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217912
Predicted Effect probably damaging
Transcript: ENSMUST00000218087
AA Change: D45G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218736
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ligand of natural killer group 2, member D (NKG2D), an immune system-activating receptor on NK cells and T-cells. Binding of the encoded ligand to NKG2D leads to activation of several signal transduction pathways, including those of JAK2, STAT5, ERK and PI3K kinase/Akt. Also, in cytomegalovirus-infected cells, this ligand binds the UL16 glycoprotein and is prevented from activating the immune system. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Ulbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1463:Ulbp1 UTSW 10 7446557 splice site probably benign
R2309:Ulbp1 UTSW 10 7447388 missense probably benign 0.03
R4486:Ulbp1 UTSW 10 7447397 missense probably benign 0.03
R4977:Ulbp1 UTSW 10 7447391 missense probably benign 0.31
R5568:Ulbp1 UTSW 10 7473281 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGCTCCAGATGTTCTTTCC -3'
(R):5'- TCTAAGATATCCAGCAGCAAGGG -3'

Sequencing Primer
(F):5'- GTTCTTTCCAGTGCAACATGAG -3'
(R):5'- TATCCAGCAGCAAGGGCAAAATATAG -3'
Posted On2015-08-18