Incidental Mutation 'R4542:E2f7'
ID333593
Institutional Source Beutler Lab
Gene Symbol E2f7
Ensembl Gene ENSMUSG00000020185
Gene NameE2F transcription factor 7
SynonymsD10Ertd739e, A630014C11Rik, E2F7
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location110745439-110787384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110767123 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 333 (V333E)
Ref Sequence ENSEMBL: ENSMUSP00000133494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073781] [ENSMUST00000173471]
Predicted Effect probably damaging
Transcript: ENSMUST00000073781
AA Change: V333E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073453
Gene: ENSMUSG00000020185
AA Change: V333E

DomainStartEndE-ValueType
E2F_TDP 143 212 1.12e-28 SMART
E2F_TDP 283 368 1.28e-32 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 755 767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173471
AA Change: V333E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133494
Gene: ENSMUSG00000020185
AA Change: V333E

DomainStartEndE-ValueType
Pfam:E2F_TDP 143 212 1.8e-23 PFAM
Pfam:E2F_TDP 283 368 3.7e-24 PFAM
low complexity region 591 602 N/A INTRINSIC
low complexity region 755 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173948
SMART Domains Protein: ENSMUSP00000134039
Gene: ENSMUSG00000020185

DomainStartEndE-ValueType
E2F_TDP 29 98 1.12e-28 SMART
E2F_TDP 169 219 3.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174810
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] E2F transcription factors, such as E2F7, play an essential role in the regulation of cell cycle progression (Di Stefano et al., 2003 [PubMed 14633988]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop normally through puberty and survive to old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in E2f7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:E2f7 APN 10 110754093 missense probably benign 0.09
IGL01592:E2f7 APN 10 110746406 missense possibly damaging 0.86
IGL01614:E2f7 APN 10 110759978 missense probably damaging 1.00
IGL01829:E2f7 APN 10 110779094 missense probably benign 0.00
IGL01843:E2f7 APN 10 110774735 missense probably benign 0.01
IGL02683:E2f7 APN 10 110782459 missense probably benign 0.28
IGL03229:E2f7 APN 10 110754346 missense probably benign 0.04
R0245:E2f7 UTSW 10 110774795 nonsense probably null
R2108:E2f7 UTSW 10 110780902 missense probably benign 0.20
R2259:E2f7 UTSW 10 110746343 missense probably damaging 0.99
R3408:E2f7 UTSW 10 110784717 missense possibly damaging 0.57
R4356:E2f7 UTSW 10 110759851 missense probably damaging 0.98
R4763:E2f7 UTSW 10 110780849 missense probably damaging 0.97
R5236:E2f7 UTSW 10 110767209 missense probably damaging 1.00
R5520:E2f7 UTSW 10 110759945 missense probably damaging 1.00
R6481:E2f7 UTSW 10 110774681 missense probably damaging 1.00
R7253:E2f7 UTSW 10 110766303 intron probably null
R7320:E2f7 UTSW 10 110764130 missense not run
R7348:E2f7 UTSW 10 110780975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGTTGTGTGTCTGCAGAG -3'
(R):5'- CGGGAAAAGGCCAGTTTTG -3'

Sequencing Primer
(F):5'- TGTCTGCAGAGGATTCAGGGAC -3'
(R):5'- GAAAAGGCCAGTTTTGCTGTCTAC -3'
Posted On2015-08-18