Incidental Mutation 'R4542:Nr2f1'
ID333601
Institutional Source Beutler Lab
Gene Symbol Nr2f1
Ensembl Gene ENSMUSG00000069171
Gene Namenuclear receptor subfamily 2, group F, member 1
SynonymsErbal3, COUP-TF1, Tcfcoup1, COUP-TFI
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location78188973-78199757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78189821 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 235 (G235D)
Ref Sequence ENSEMBL: ENSMUSP00000118161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091458] [ENSMUST00000125176] [ENSMUST00000127137] [ENSMUST00000150498]
Predicted Effect probably damaging
Transcript: ENSMUST00000091458
AA Change: G392D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089036
Gene: ENSMUSG00000069171
AA Change: G392D

DomainStartEndE-ValueType
low complexity region 16 65 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ZnF_C4 80 151 3.01e-39 SMART
HOLI 218 378 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125176
AA Change: G245D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122618
Gene: ENSMUSG00000069171
AA Change: G245D

DomainStartEndE-ValueType
HOLI 71 231 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127137
AA Change: G235D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133704
Gene: ENSMUSG00000069171
AA Change: G235D

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135284
Predicted Effect probably damaging
Transcript: ENSMUST00000150498
AA Change: G235D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118161
Gene: ENSMUSG00000069171
AA Change: G235D

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor and transcriptional regulator. The encoded protein acts as a homodimer and binds to 5'-AGGTCA-3' repeats. Defects in this gene are a cause of Bosch-Boonstra optic atrophy syndrome (BBOAS). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for a null allele die perinatally with axon guidance defects in all forebrain commissures. Homozygotes for another null allele show neonatal death, impaired cranial ganglion IX formation and axon guidance, increased cochlear HC and support cell number, and altered cortex regionalization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Nr2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Nr2f1 APN 13 78189833 missense probably damaging 1.00
IGL00553:Nr2f1 APN 13 78198242 missense probably damaging 1.00
IGL00821:Nr2f1 APN 13 78198114 unclassified probably benign
IGL02346:Nr2f1 APN 13 78195408 missense probably damaging 1.00
IGL02586:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02587:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02588:Nr2f1 APN 13 78195156 unclassified probably benign
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1865:Nr2f1 UTSW 13 78189926 missense probably damaging 1.00
R1959:Nr2f1 UTSW 13 78189816 missense probably damaging 1.00
R2284:Nr2f1 UTSW 13 78195462 missense probably damaging 1.00
R3861:Nr2f1 UTSW 13 78195675 nonsense probably null
R6248:Nr2f1 UTSW 13 78196492 intron probably benign
R6285:Nr2f1 UTSW 13 78195663 missense probably benign 0.01
R7305:Nr2f1 UTSW 13 78195179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGGTTTGCAGCTCAG -3'
(R):5'- ATGCTGCCCACATCGAAAGC -3'

Sequencing Primer
(F):5'- AGCATCCCCAAAGGCTTTTTAG -3'
(R):5'- CCTGCAGGAGAAATCACAGTGTG -3'
Posted On2015-08-18