Incidental Mutation 'R4542:Nt5dc2'
ID333602
Institutional Source Beutler Lab
Gene Symbol Nt5dc2
Ensembl Gene ENSMUSG00000071547
Gene Name5'-nucleotidase domain containing 2
Synonyms
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31131053-31139124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31138138 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 374 (D374E)
Ref Sequence ENSEMBL: ENSMUSP00000154475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000226588] [ENSMUST00000227096] [ENSMUST00000227794]
Predicted Effect probably benign
Transcript: ENSMUST00000036618
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090212
AA Change: D211E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547
AA Change: D211E

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 367 1.5e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159208
Predicted Effect probably benign
Transcript: ENSMUST00000159249
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect probably benign
Transcript: ENSMUST00000160024
SMART Domains Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
Blast:FAS1 1 32 5e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Predicted Effect probably benign
Transcript: ENSMUST00000226588
Predicted Effect unknown
Transcript: ENSMUST00000226975
AA Change: D284E
Predicted Effect probably benign
Transcript: ENSMUST00000227096
AA Change: D374E

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227690
Predicted Effect probably benign
Transcript: ENSMUST00000227794
AA Change: D314E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Rfx1 G A 8: 84,090,237 G466S probably damaging Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Nt5dc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1782:Nt5dc2 UTSW 14 31138201 missense probably damaging 1.00
R3974:Nt5dc2 UTSW 14 31138875 missense probably damaging 1.00
R3975:Nt5dc2 UTSW 14 31138875 missense probably damaging 1.00
R3976:Nt5dc2 UTSW 14 31138875 missense probably damaging 1.00
R4677:Nt5dc2 UTSW 14 31138921 missense possibly damaging 0.61
R4953:Nt5dc2 UTSW 14 31138921 missense possibly damaging 0.61
R5092:Nt5dc2 UTSW 14 31139032 missense possibly damaging 0.86
R6523:Nt5dc2 UTSW 14 31135705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGTGTTTCTACCGCAG -3'
(R):5'- CCGTGTTGATGATGCGGATCTC -3'

Sequencing Primer
(F):5'- TCCTATTGGAAGGGGGAAGC -3'
(R):5'- AGCTCAGGGATGATGGCTC -3'
Posted On2015-08-18