Incidental Mutation 'R4544:Lmo2'
ID333656
Institutional Source Beutler Lab
Gene Symbol Lmo2
Ensembl Gene ENSMUSG00000032698
Gene NameLIM domain only 2
SynonymsRbtn2, Rhom-2, Rbtn-2
MMRRC Submission 041779-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4544 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103957986-103981878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103976037 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 25 (P25L)
Ref Sequence ENSEMBL: ENSMUSP00000128317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111139] [ENSMUST00000111140] [ENSMUST00000111143] [ENSMUST00000123437] [ENSMUST00000138815] [ENSMUST00000156813] [ENSMUST00000170926]
Predicted Effect probably benign
Transcript: ENSMUST00000111139
SMART Domains Protein: ENSMUSP00000106769
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 91 145 1.71e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111140
AA Change: P95L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106770
Gene: ENSMUSG00000032698
AA Change: P95L

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 99 153 4.03e-10 SMART
LIM 163 217 1.71e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111143
AA Change: P87L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106773
Gene: ENSMUSG00000032698
AA Change: P87L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
LIM 91 145 4.03e-10 SMART
LIM 155 209 1.71e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123437
AA Change: P25L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117703
Gene: ENSMUSG00000032698
AA Change: P25L

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133210
Predicted Effect probably damaging
Transcript: ENSMUST00000138815
AA Change: P25L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121927
Gene: ENSMUSG00000032698
AA Change: P25L

DomainStartEndE-ValueType
Pfam:LIM 30 59 2.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156813
AA Change: P25L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122369
Gene: ENSMUSG00000032698
AA Change: P25L

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 144 1.36e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170926
AA Change: P25L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128317
Gene: ENSMUSG00000032698
AA Change: P25L

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lack of yolk sac erythropoiesis and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
C1s1 A G 6: 124,531,540 S497P probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Chil4 C A 3: 106,210,606 R116L probably damaging Het
Cmpk2 A G 12: 26,478,017 E411G probably damaging Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Csmd1 A T 8: 16,710,636 F161Y possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Dppa3 A G 6: 122,626,767 probably benign Het
Ednra A G 8: 77,674,911 probably null Het
Fancd2 A G 6: 113,572,642 probably null Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Fndc1 T A 17: 7,773,544 D440V unknown Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gm9934 A G 7: 93,052,980 noncoding transcript Het
Ifi205 T C 1: 174,026,573 I171M possibly damaging Het
Ifi213 T C 1: 173,582,127 probably null Het
Insig2 A T 1: 121,312,192 probably benign Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Krt23 G A 11: 99,478,276 T397M probably benign Het
Lepr G A 4: 101,768,228 V527I possibly damaging Het
Lsr C T 7: 30,971,976 V111M probably damaging Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Mkx T C 18: 7,000,651 Y97C probably damaging Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Myo9b T C 8: 71,327,941 V494A probably damaging Het
Nek1 C T 8: 61,016,304 Q132* probably null Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Olfr774 A C 10: 129,238,158 N3T probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Pex10 T C 4: 155,070,495 Y235H probably benign Het
Pik3cb T A 9: 99,039,759 K1050I probably damaging Het
Prss56 A G 1: 87,184,642 D85G probably damaging Het
Psg26 T C 7: 18,478,539 N297S probably damaging Het
Rdh16f1 T C 10: 127,790,837 L253S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Slc8b1 G A 5: 120,531,153 probably null Het
Sorbs1 G A 19: 40,311,850 T575M probably damaging Het
Syne3 T A 12: 104,959,469 K313M probably damaging Het
Tas2r108 A G 6: 40,493,808 T73A probably benign Het
Ttn T C 2: 76,822,588 probably null Het
Ubr3 G A 2: 69,956,093 M850I probably benign Het
Vmn2r78 A T 7: 86,921,191 M306L probably benign Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Lmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Lmo2 APN 2 103981087 missense probably benign 0.21
R1983:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2013:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2014:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2131:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2132:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2133:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2233:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2235:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2510:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3038:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3813:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4058:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4059:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4448:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4450:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4805:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4808:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4975:Lmo2 UTSW 2 103976143 nonsense probably null
R5310:Lmo2 UTSW 2 103976100 missense probably damaging 0.98
R5823:Lmo2 UTSW 2 103981072 missense probably damaging 1.00
R6267:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6296:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6949:Lmo2 UTSW 2 103970673 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- TGATAAGGTCTCTCTAGCCCAC -3'
(R):5'- TGCACAATTTCCGTCCCAGC -3'

Sequencing Primer
(F):5'- ATCCAAGGTTGTCTGTGTCTATGCAG -3'
(R):5'- AATTTCCGTCCCAGCTTGTAGTAGAG -3'
Posted On2015-08-18