Incidental Mutation 'R4544:Mkx'
ID333698
Institutional Source Beutler Lab
Gene Symbol Mkx
Ensembl Gene ENSMUSG00000061013
Gene Namemohawk homeobox
Synonyms9430023B20Rik, Irxl1
MMRRC Submission 041779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4544 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6910459-7004780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7000651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 97 (Y97C)
Ref Sequence ENSEMBL: ENSMUSP00000078718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079788]
Predicted Effect probably damaging
Transcript: ENSMUST00000079788
AA Change: Y97C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078718
Gene: ENSMUSG00000061013
AA Change: Y97C

DomainStartEndE-ValueType
HOX 71 135 5.01e-4 SMART
low complexity region 158 171 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176757
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thin, hypoplastic tendons with reduced tensile strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
C1s1 A G 6: 124,531,540 S497P probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Chil4 C A 3: 106,210,606 R116L probably damaging Het
Cmpk2 A G 12: 26,478,017 E411G probably damaging Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Csmd1 A T 8: 16,710,636 F161Y possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Dppa3 A G 6: 122,626,767 probably benign Het
Ednra A G 8: 77,674,911 probably null Het
Fancd2 A G 6: 113,572,642 probably null Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Fndc1 T A 17: 7,773,544 D440V unknown Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gm9934 A G 7: 93,052,980 noncoding transcript Het
Ifi205 T C 1: 174,026,573 I171M possibly damaging Het
Ifi213 T C 1: 173,582,127 probably null Het
Insig2 A T 1: 121,312,192 probably benign Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Krt23 G A 11: 99,478,276 T397M probably benign Het
Lepr G A 4: 101,768,228 V527I possibly damaging Het
Lmo2 C T 2: 103,976,037 P25L probably damaging Het
Lsr C T 7: 30,971,976 V111M probably damaging Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Myo9b T C 8: 71,327,941 V494A probably damaging Het
Nek1 C T 8: 61,016,304 Q132* probably null Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Olfr774 A C 10: 129,238,158 N3T probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Pex10 T C 4: 155,070,495 Y235H probably benign Het
Pik3cb T A 9: 99,039,759 K1050I probably damaging Het
Prss56 A G 1: 87,184,642 D85G probably damaging Het
Psg26 T C 7: 18,478,539 N297S probably damaging Het
Rdh16f1 T C 10: 127,790,837 L253S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Slc8b1 G A 5: 120,531,153 probably null Het
Sorbs1 G A 19: 40,311,850 T575M probably damaging Het
Syne3 T A 12: 104,959,469 K313M probably damaging Het
Tas2r108 A G 6: 40,493,808 T73A probably benign Het
Ttn T C 2: 76,822,588 probably null Het
Ubr3 G A 2: 69,956,093 M850I probably benign Het
Vmn2r78 A T 7: 86,921,191 M306L probably benign Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Mkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mkx APN 18 6937192 missense probably benign
IGL02478:Mkx APN 18 7002418 missense probably damaging 0.99
IGL02676:Mkx APN 18 7000640 missense probably benign 0.08
IGL02806:Mkx APN 18 6937025 missense probably damaging 1.00
R0766:Mkx UTSW 18 6937192 missense probably benign 0.05
R1273:Mkx UTSW 18 7002460 missense probably benign
R1312:Mkx UTSW 18 6937192 missense probably benign 0.05
R1496:Mkx UTSW 18 6992330 nonsense probably null
R2083:Mkx UTSW 18 6992855 missense probably damaging 0.99
R2196:Mkx UTSW 18 7000675 missense probably damaging 0.99
R3013:Mkx UTSW 18 6936929 missense probably damaging 0.99
R4646:Mkx UTSW 18 6992040 missense probably benign 0.43
R4798:Mkx UTSW 18 7002432 missense probably benign
R4887:Mkx UTSW 18 6992904 missense probably damaging 1.00
R4945:Mkx UTSW 18 7000657 missense possibly damaging 0.76
R6129:Mkx UTSW 18 6992888 missense probably damaging 0.98
R6267:Mkx UTSW 18 7000591 critical splice donor site probably null
R6271:Mkx UTSW 18 6937059 splice site probably null
R6296:Mkx UTSW 18 7000591 critical splice donor site probably null
R6569:Mkx UTSW 18 6992820 nonsense probably null
R7165:Mkx UTSW 18 7002525 missense probably damaging 0.97
R7365:Mkx UTSW 18 7000747 missense possibly damaging 0.85
Z1088:Mkx UTSW 18 6936975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCATCCTCTGTGGCAAC -3'
(R):5'- TGCTGACATCTCAGAAATGCGG -3'

Sequencing Primer
(F):5'- AGATCTGGACCTGCCTCTGAAC -3'
(R):5'- CTCAGAAATGCGGTCTATCATGG -3'
Posted On2015-08-18