Incidental Mutation 'R4546:Muc15'
ID333753
Institutional Source Beutler Lab
Gene Symbol Muc15
Ensembl Gene ENSMUSG00000050808
Gene Namemucin 15
Synonyms
MMRRC Submission 041780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4546 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location110721340-110739527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110737499 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 330 (S330P)
Ref Sequence ENSEMBL: ENSMUSP00000106645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090332] [ENSMUST00000099623] [ENSMUST00000111016] [ENSMUST00000111017] [ENSMUST00000140777]
Predicted Effect probably damaging
Transcript: ENSMUST00000090332
AA Change: S330P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087805
Gene: ENSMUSG00000050808
AA Change: S330P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin15 21 331 2.3e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111016
AA Change: S330P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106645
Gene: ENSMUSG00000050808
AA Change: S330P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111017
SMART Domains Protein: ENSMUSP00000106646
Gene: ENSMUSG00000050808

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140777
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,156,478 S236L probably benign Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Alpi T A 1: 87,099,117 Y413F probably damaging Het
Asmt T C X: 170,676,495 probably null Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Bnc2 A G 4: 84,291,976 F744L probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Cdk13 T C 13: 17,766,574 K21R probably damaging Het
Cenpf A C 1: 189,654,650 L1811R probably damaging Het
Cr2 A G 1: 195,171,041 I43T possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cylc2 A T 4: 51,229,840 D394V unknown Het
Dcaf8 T C 1: 172,179,893 probably benign Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnah12 A T 14: 26,773,014 Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,097 R522G probably benign Het
F2rl3 C T 8: 72,762,583 A146V probably benign Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Glrb T C 3: 80,879,686 S57G probably damaging Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm4737 C T 16: 46,153,967 C349Y possibly damaging Het
Gm5507 T A 18: 53,984,337 noncoding transcript Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Il21r A G 7: 125,628,899 R181G probably damaging Het
Il5ra G T 6: 106,738,498 S125* probably null Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Lepr T A 4: 101,814,641 I954N probably benign Het
Lims1 T C 10: 58,418,790 probably benign Het
Maats1 C T 16: 38,335,523 V113I probably benign Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Nkd2 T C 13: 73,823,356 D187G probably benign Het
Nphp1 C T 2: 127,766,019 probably null Het
Olfr1129 T C 2: 87,575,186 F34S probably benign Het
Olfr378 T C 11: 73,425,186 N266D probably benign Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pdhx A T 2: 103,073,397 L18Q probably null Het
Pear1 C T 3: 87,754,661 G469D probably damaging Het
Plec T C 15: 76,181,557 T1506A probably benign Het
Plod3 T A 5: 136,988,947 D192E possibly damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Tmem200c A G 17: 68,842,171 D583G probably benign Het
Trpm6 A G 19: 18,832,477 Y1079C probably damaging Het
Ttn T C 2: 76,822,588 probably null Het
Vcp T C 4: 42,988,813 probably benign Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Wdr11 A G 7: 129,629,005 E878G probably damaging Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Muc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Muc15 APN 2 110731596 missense probably benign 0.00
IGL02547:Muc15 APN 2 110731305 missense probably damaging 0.97
IGL02751:Muc15 APN 2 110731773 missense probably benign 0.14
IGL03100:Muc15 APN 2 110731594 missense probably damaging 0.99
IGL03188:Muc15 APN 2 110731699 missense probably benign 0.14
R0684:Muc15 UTSW 2 110733815 missense possibly damaging 0.95
R1472:Muc15 UTSW 2 110731560 missense probably damaging 1.00
R1582:Muc15 UTSW 2 110737472 missense probably benign 0.16
R1661:Muc15 UTSW 2 110733898 nonsense probably null
R1665:Muc15 UTSW 2 110733898 nonsense probably null
R1725:Muc15 UTSW 2 110731246 missense probably damaging 0.96
R1815:Muc15 UTSW 2 110731258 missense probably damaging 1.00
R1892:Muc15 UTSW 2 110737352 nonsense probably null
R2022:Muc15 UTSW 2 110731476 missense probably benign 0.00
R4953:Muc15 UTSW 2 110731272 missense probably damaging 0.99
R4984:Muc15 UTSW 2 110731573 missense probably damaging 1.00
R5858:Muc15 UTSW 2 110731798 missense probably damaging 1.00
R6046:Muc15 UTSW 2 110731441 nonsense probably null
R6695:Muc15 UTSW 2 110731271 missense probably damaging 1.00
R7468:Muc15 UTSW 2 110731517 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATCAGGTGTCAGAGCATCC -3'
(R):5'- TTTTCGATGACAGATGCACCC -3'

Sequencing Primer
(F):5'- CCATTGCCGTAAAACAAGTCTGTTG -3'
(R):5'- GATGACAGATGCACCCTGCTTTTC -3'
Posted On2015-08-18