Incidental Mutation 'R4546:Nphp1'
ID 333754
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Name nephronophthisis 1 (juvenile) homolog (human)
Synonyms nephrocystin
MMRRC Submission 041780-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4546 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 127582652-127630817 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 127607939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000028857
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110357
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,393,927 (GRCm39) S236L probably benign Het
Ahcyl C T 16: 45,974,330 (GRCm39) C349Y possibly damaging Het
Alg9 C T 9: 50,716,654 (GRCm39) T409M possibly damaging Het
Alpi T A 1: 87,026,839 (GRCm39) Y413F probably damaging Het
Asmt T C X: 169,110,230 (GRCm39) probably null Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Bnc2 A G 4: 84,210,213 (GRCm39) F744L probably benign Het
Ccnyl1 G T 1: 64,762,735 (GRCm39) M347I probably benign Het
Cdk13 T C 13: 17,941,159 (GRCm39) K21R probably damaging Het
Cenpf A C 1: 189,386,847 (GRCm39) L1811R probably damaging Het
Cfap91 C T 16: 38,155,885 (GRCm39) V113I probably benign Het
Cr2 A G 1: 194,853,349 (GRCm39) I43T possibly damaging Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Cylc2 A T 4: 51,229,840 (GRCm39) D394V unknown Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
Dcaf8 T C 1: 172,007,460 (GRCm39) probably benign Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnah12 A T 14: 26,494,971 (GRCm39) Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,183 (GRCm39) R522G probably benign Het
F2rl3 C T 8: 73,489,211 (GRCm39) A146V probably benign Het
Fastkd1 C T 2: 69,542,655 (GRCm39) E51K probably damaging Het
Glrb T C 3: 80,786,993 (GRCm39) S57G probably damaging Het
Gm5507 T A 18: 54,117,409 (GRCm39) noncoding transcript Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hdac1-ps A T 17: 78,800,388 (GRCm39) T460S probably benign Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Il21r A G 7: 125,228,071 (GRCm39) R181G probably damaging Het
Il5ra G T 6: 106,715,459 (GRCm39) S125* probably null Het
Kdm7a T C 6: 39,152,406 (GRCm39) R97G probably benign Het
Lepr T A 4: 101,671,838 (GRCm39) I954N probably benign Het
Lims1 T C 10: 58,254,612 (GRCm39) probably benign Het
Mest T C 6: 30,740,679 (GRCm39) W13R probably damaging Het
Mfn2 A G 4: 147,971,909 (GRCm39) V224A probably benign Het
Muc15 T C 2: 110,567,844 (GRCm39) S330P probably damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Nkd2 T C 13: 73,971,475 (GRCm39) D187G probably benign Het
Or10ag59 T C 2: 87,405,530 (GRCm39) F34S probably benign Het
Or1e19 T C 11: 73,316,012 (GRCm39) N266D probably benign Het
Or2a12 C T 6: 42,904,348 (GRCm39) S61L probably damaging Het
Osbpl6 T C 2: 76,414,836 (GRCm39) V409A possibly damaging Het
Pdhx A T 2: 102,903,742 (GRCm39) L18Q probably null Het
Pear1 C T 3: 87,661,968 (GRCm39) G469D probably damaging Het
Plec T C 15: 76,065,757 (GRCm39) T1506A probably benign Het
Plod3 T A 5: 137,017,801 (GRCm39) D192E possibly damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Slc7a8 C G 14: 54,973,247 (GRCm39) G240A possibly damaging Het
Tmem200c A G 17: 69,149,166 (GRCm39) D583G probably benign Het
Trpm6 A G 19: 18,809,841 (GRCm39) Y1079C probably damaging Het
Ttn T C 2: 76,652,932 (GRCm39) probably null Het
Vcp T C 4: 42,988,813 (GRCm39) probably benign Het
Vmn2r78 T C 7: 86,603,811 (GRCm39) V663A probably damaging Het
Vmn2r9 T G 5: 108,995,551 (GRCm39) M366L probably benign Het
Wdr11 A G 7: 129,230,729 (GRCm39) E878G probably damaging Het
Zan C G 5: 137,382,096 (GRCm39) M5150I unknown Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127,605,805 (GRCm39) missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127,605,769 (GRCm39) missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127,622,056 (GRCm39) missense probably benign 0.06
IGL01893:Nphp1 APN 2 127,611,564 (GRCm39) missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127,621,989 (GRCm39) missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127,595,969 (GRCm39) missense probably benign 0.03
IGL02340:Nphp1 APN 2 127,621,987 (GRCm39) nonsense probably null
IGL02836:Nphp1 APN 2 127,611,543 (GRCm39) missense probably benign 0.00
IGL03109:Nphp1 APN 2 127,610,089 (GRCm39) critical splice donor site probably benign
R1632:Nphp1 UTSW 2 127,612,312 (GRCm39) missense probably benign 0.32
R1857:Nphp1 UTSW 2 127,612,296 (GRCm39) missense probably benign 0.00
R4425:Nphp1 UTSW 2 127,630,719 (GRCm39) missense possibly damaging 0.82
R4514:Nphp1 UTSW 2 127,590,007 (GRCm39) missense probably benign 0.26
R4580:Nphp1 UTSW 2 127,610,089 (GRCm39) critical splice donor site probably null
R5634:Nphp1 UTSW 2 127,601,570 (GRCm39) missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127,595,899 (GRCm39) missense probably benign
R7326:Nphp1 UTSW 2 127,603,137 (GRCm39) missense possibly damaging 0.76
R7985:Nphp1 UTSW 2 127,587,829 (GRCm39) missense probably damaging 0.97
R8029:Nphp1 UTSW 2 127,583,036 (GRCm39) missense probably benign 0.00
R8715:Nphp1 UTSW 2 127,605,729 (GRCm39) missense possibly damaging 0.91
R8967:Nphp1 UTSW 2 127,582,897 (GRCm39) missense probably damaging 1.00
R8997:Nphp1 UTSW 2 127,595,982 (GRCm39) missense possibly damaging 0.88
R9328:Nphp1 UTSW 2 127,582,892 (GRCm39) missense possibly damaging 0.77
R9450:Nphp1 UTSW 2 127,616,008 (GRCm39) missense
R9755:Nphp1 UTSW 2 127,595,951 (GRCm39) nonsense probably null
X0022:Nphp1 UTSW 2 127,603,134 (GRCm39) missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127,621,047 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GATAGTTGGGGTTACATAGTAAGACC -3'
(R):5'- CGTGGAACGATATCAATTTAGGG -3'

Sequencing Primer
(F):5'- GGGTTACATAGTAAGACCTTGTCTC -3'
(R):5'- TGGAACGATATCAATTTAGGGTTTTG -3'
Posted On 2015-08-18