Incidental Mutation 'R4546:Dlec1'
ID333783
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission 041780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4546 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119128078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 796 (I796F)
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect probably benign
Transcript: ENSMUST00000055775
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138736
Predicted Effect probably damaging
Transcript: ENSMUST00000140326
AA Change: I796F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: I796F

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148611
Predicted Effect probably damaging
Transcript: ENSMUST00000165231
AA Change: I796F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: I796F

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,156,478 S236L probably benign Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Alpi T A 1: 87,099,117 Y413F probably damaging Het
Asmt T C X: 170,676,495 probably null Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Bnc2 A G 4: 84,291,976 F744L probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Cdk13 T C 13: 17,766,574 K21R probably damaging Het
Cenpf A C 1: 189,654,650 L1811R probably damaging Het
Cr2 A G 1: 195,171,041 I43T possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cylc2 A T 4: 51,229,840 D394V unknown Het
Dcaf8 T C 1: 172,179,893 probably benign Het
Dnah12 A T 14: 26,773,014 Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,097 R522G probably benign Het
F2rl3 C T 8: 72,762,583 A146V probably benign Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Glrb T C 3: 80,879,686 S57G probably damaging Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm4737 C T 16: 46,153,967 C349Y possibly damaging Het
Gm5507 T A 18: 53,984,337 noncoding transcript Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Il21r A G 7: 125,628,899 R181G probably damaging Het
Il5ra G T 6: 106,738,498 S125* probably null Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Lepr T A 4: 101,814,641 I954N probably benign Het
Lims1 T C 10: 58,418,790 probably benign Het
Maats1 C T 16: 38,335,523 V113I probably benign Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Muc15 T C 2: 110,737,499 S330P probably damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Nkd2 T C 13: 73,823,356 D187G probably benign Het
Nphp1 C T 2: 127,766,019 probably null Het
Olfr1129 T C 2: 87,575,186 F34S probably benign Het
Olfr378 T C 11: 73,425,186 N266D probably benign Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pdhx A T 2: 103,073,397 L18Q probably null Het
Pear1 C T 3: 87,754,661 G469D probably damaging Het
Plec T C 15: 76,181,557 T1506A probably benign Het
Plod3 T A 5: 136,988,947 D192E possibly damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Tmem200c A G 17: 68,842,171 D583G probably benign Het
Trpm6 A G 19: 18,832,477 Y1079C probably damaging Het
Ttn T C 2: 76,822,588 probably null Het
Vcp T C 4: 42,988,813 probably benign Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Wdr11 A G 7: 129,629,005 E878G probably damaging Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 intron probably null
Predicted Primers PCR Primer
(F):5'- TTCAGATGGTCAGCAGCCAG -3'
(R):5'- AAAATCTCCGACCTCATTGGG -3'

Sequencing Primer
(F):5'- GCAGAGCATCATATGATCCCTCGG -3'
(R):5'- ACCTCATTGGGCTCTGGAGAG -3'
Posted On2015-08-18