Incidental Mutation 'R4548:Cntln'
ID333856
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Namecentlein, centrosomal protein
SynonymsB430108F07Rik, D530005L17Rik
MMRRC Submission 041594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R4548 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location84884309-85131921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85096842 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1123 (H1123Q)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: H1124Q

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: H1124Q

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107190
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: H1123Q

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: H1123Q

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,334,271 F155L possibly damaging Het
Adcy6 A G 15: 98,598,659 I545T probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Anln T C 9: 22,362,888 D551G possibly damaging Het
Arhgef17 T C 7: 100,931,129 Q204R possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl2l11 A G 2: 128,129,646 E75G probably benign Het
Cfap45 A G 1: 172,545,108 I457V probably benign Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cops3 C T 11: 59,827,845 probably null Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnajc11 A G 4: 151,973,617 N281S possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fras1 A G 5: 96,709,895 D2016G probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Greb1 T C 12: 16,699,675 D1050G probably damaging Het
Kcnh6 T C 11: 106,009,049 F48S probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Myzap T C 9: 71,550,246 E289G possibly damaging Het
Nemp1 A G 10: 127,696,344 E373G probably benign Het
Olfr1100 T C 2: 86,978,670 N42S probably damaging Het
Olfr155 T A 4: 43,854,834 I175N probably damaging Het
Polr1c A T 17: 46,247,809 probably null Het
Rev1 A G 1: 38,059,194 M756T possibly damaging Het
Sacs A G 14: 61,191,938 D482G probably damaging Het
Sfrp4 A G 13: 19,623,766 M112V possibly damaging Het
Slc7a4 T C 16: 17,575,345 T197A probably benign Het
Snx27 C T 3: 94,526,439 probably benign Het
Spata5 T A 3: 37,432,027 N299K probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Ssh2 G A 11: 77,450,184 A721T probably benign Het
Trappc3 A G 4: 126,272,751 D39G possibly damaging Het
Ttc28 G A 5: 111,271,224 S1362N possibly damaging Het
Ugt2b35 A T 5: 87,008,275 K409* probably null Het
Vmn2r92 A T 17: 18,171,316 M527L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACTGTTATTGATGCTCCTCTATGGTC -3'
(R):5'- GCAACTAGATTGTCGTAAATCATGC -3'

Sequencing Primer
(F):5'- ATGCTCCTCTATGGTCTGGCATG -3'
(R):5'- AAGGTAAATGCTGGTATTGT -3'
Posted On2015-08-18