Incidental Mutation 'R0207:Wnk1'
ID33388
Institutional Source Beutler Lab
Gene Symbol Wnk1
Ensembl Gene ENSMUSG00000045962
Gene NameWNK lysine deficient protein kinase 1
Synonyms6430573H23Rik, Hsn2, EG406236, Prkwnk1
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0207 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119923969-120038672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119952733 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1016 (S1016R)
Ref Sequence ENSEMBL: ENSMUSP00000063001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060043] [ENSMUST00000088644] [ENSMUST00000088646] [ENSMUST00000160686] [ENSMUST00000177761] [ENSMUST00000203030]
Predicted Effect probably damaging
Transcript: ENSMUST00000060043
AA Change: S1016R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063001
Gene: ENSMUSG00000045962
AA Change: S1016R

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.5e-44 PFAM
Pfam:Pkinase 221 479 4.4e-58 PFAM
Pfam:OSR1_C 500 537 2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 865 876 N/A INTRINSIC
low complexity region 1018 1028 N/A INTRINSIC
low complexity region 1042 1058 N/A INTRINSIC
internal_repeat_1 1136 1178 2.15e-5 PROSPERO
low complexity region 1289 1305 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1398 1428 N/A INTRINSIC
low complexity region 1429 1454 N/A INTRINSIC
low complexity region 1496 1515 N/A INTRINSIC
low complexity region 1542 1556 N/A INTRINSIC
low complexity region 1586 1609 N/A INTRINSIC
low complexity region 1670 1691 N/A INTRINSIC
low complexity region 1698 1712 N/A INTRINSIC
low complexity region 1738 1764 N/A INTRINSIC
low complexity region 1882 1900 N/A INTRINSIC
coiled coil region 2065 2092 N/A INTRINSIC
low complexity region 2103 2114 N/A INTRINSIC
low complexity region 2116 2140 N/A INTRINSIC
low complexity region 2208 2232 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088644
AA Change: S1274R

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086017
Gene: ENSMUSG00000045962
AA Change: S1274R

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 5.5e-44 PFAM
Pfam:Pkinase 221 479 4.3e-56 PFAM
Pfam:OSR1_C 500 537 1.9e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1146 1158 N/A INTRINSIC
low complexity region 1276 1286 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
internal_repeat_1 1394 1436 2.19e-5 PROSPERO
low complexity region 1547 1563 N/A INTRINSIC
low complexity region 1603 1615 N/A INTRINSIC
low complexity region 1637 1654 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
low complexity region 1687 1712 N/A INTRINSIC
low complexity region 1754 1773 N/A INTRINSIC
low complexity region 1800 1814 N/A INTRINSIC
low complexity region 1844 1867 N/A INTRINSIC
low complexity region 1928 1949 N/A INTRINSIC
low complexity region 1956 1970 N/A INTRINSIC
low complexity region 1996 2022 N/A INTRINSIC
low complexity region 2140 2158 N/A INTRINSIC
coiled coil region 2323 2350 N/A INTRINSIC
low complexity region 2361 2372 N/A INTRINSIC
low complexity region 2374 2398 N/A INTRINSIC
low complexity region 2466 2490 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088646
AA Change: S862R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086019
Gene: ENSMUSG00000045962
AA Change: S862R

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.3e-44 PFAM
Pfam:Pkinase 221 479 4e-58 PFAM
Pfam:OSR1_C 500 537 1.8e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 864 874 N/A INTRINSIC
low complexity region 888 904 N/A INTRINSIC
internal_repeat_1 982 1024 7.56e-6 PROSPERO
low complexity region 1135 1151 N/A INTRINSIC
low complexity region 1191 1203 N/A INTRINSIC
low complexity region 1225 1242 N/A INTRINSIC
low complexity region 1244 1274 N/A INTRINSIC
low complexity region 1275 1300 N/A INTRINSIC
low complexity region 1342 1361 N/A INTRINSIC
low complexity region 1388 1402 N/A INTRINSIC
low complexity region 1432 1455 N/A INTRINSIC
low complexity region 1516 1537 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1584 1610 N/A INTRINSIC
low complexity region 1700 1718 N/A INTRINSIC
coiled coil region 1883 1910 N/A INTRINSIC
low complexity region 1921 1932 N/A INTRINSIC
low complexity region 1934 1958 N/A INTRINSIC
low complexity region 2026 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159397
Predicted Effect unknown
Transcript: ENSMUST00000159785
AA Change: S156R
SMART Domains Protein: ENSMUSP00000124905
Gene: ENSMUSG00000045962
AA Change: S156R

DomainStartEndE-ValueType
low complexity region 159 169 N/A INTRINSIC
low complexity region 183 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160686
SMART Domains Protein: ENSMUSP00000137334
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 102 115 N/A INTRINSIC
low complexity region 119 128 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160769
Predicted Effect probably benign
Transcript: ENSMUST00000161048
SMART Domains Protein: ENSMUSP00000125345
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
Blast:S_TKc 2 68 3e-34 BLAST
SCOP:d1phk__ 3 70 2e-7 SMART
Pfam:OSR1_C 89 126 9.5e-21 PFAM
coiled coil region 151 185 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161185
Predicted Effect probably benign
Transcript: ENSMUST00000161802
SMART Domains Protein: ENSMUSP00000124724
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162368
SMART Domains Protein: ENSMUSP00000125383
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162541
SMART Domains Protein: ENSMUSP00000125193
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 63 84 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 131 157 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177761
SMART Domains Protein: ENSMUSP00000136777
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.7e-44 PFAM
Pfam:Pkinase 221 479 5.1e-58 PFAM
Pfam:OSR1_C 500 537 2.2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
low complexity region 828 839 N/A INTRINSIC
low complexity region 1005 1021 N/A INTRINSIC
low complexity region 1136 1149 N/A INTRINSIC
low complexity region 1153 1162 N/A INTRINSIC
low complexity region 1232 1244 N/A INTRINSIC
low complexity region 1291 1307 N/A INTRINSIC
internal_repeat_1 1385 1427 1.91e-5 PROSPERO
low complexity region 1538 1554 N/A INTRINSIC
low complexity region 1594 1606 N/A INTRINSIC
low complexity region 1628 1645 N/A INTRINSIC
low complexity region 1647 1677 N/A INTRINSIC
low complexity region 1678 1703 N/A INTRINSIC
low complexity region 1745 1764 N/A INTRINSIC
low complexity region 1791 1805 N/A INTRINSIC
low complexity region 1835 1858 N/A INTRINSIC
low complexity region 1919 1940 N/A INTRINSIC
low complexity region 1947 1961 N/A INTRINSIC
low complexity region 1987 2013 N/A INTRINSIC
low complexity region 2131 2149 N/A INTRINSIC
coiled coil region 2314 2341 N/A INTRINSIC
low complexity region 2352 2363 N/A INTRINSIC
low complexity region 2365 2389 N/A INTRINSIC
low complexity region 2457 2481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203030
SMART Domains Protein: ENSMUSP00000145304
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 4.1e-44 PFAM
Pfam:Pkinase 221 479 3.2e-56 PFAM
Pfam:OSR1_C 500 537 1.5e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 793 809 N/A INTRINSIC
internal_repeat_1 887 929 5.8e-6 PROSPERO
low complexity region 1040 1056 N/A INTRINSIC
low complexity region 1096 1108 N/A INTRINSIC
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1149 1179 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1247 1266 N/A INTRINSIC
low complexity region 1293 1307 N/A INTRINSIC
low complexity region 1337 1360 N/A INTRINSIC
low complexity region 1421 1442 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1489 1515 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
coiled coil region 1816 1843 N/A INTRINSIC
low complexity region 1854 1865 N/A INTRINSIC
low complexity region 1867 1891 N/A INTRINSIC
low complexity region 1959 1983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204207
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die before birth, whereas heterozygotes survive and exhibit decreased blood pressure. Mice homozygous for an allele that does not produce the kidney isoform exhibit a slight increase in systemic arterial diastolic blood pressure and reduced sensitivity to amiloride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Wnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Wnk1 APN 6 119960708 missense probably damaging 1.00
IGL01364:Wnk1 APN 6 119937411 missense probably damaging 1.00
IGL01715:Wnk1 APN 6 119948397 missense probably damaging 1.00
IGL01951:Wnk1 APN 6 119963485 missense probably damaging 0.99
IGL02043:Wnk1 APN 6 119949078 unclassified probably benign
IGL02268:Wnk1 APN 6 119937373 nonsense probably null
IGL02348:Wnk1 APN 6 119963328 missense probably damaging 0.98
IGL02425:Wnk1 APN 6 119963454 missense probably damaging 1.00
IGL02850:Wnk1 APN 6 119937862 missense probably benign 0.26
IGL03160:Wnk1 APN 6 119926633 missense probably damaging 1.00
IGL03387:Wnk1 APN 6 119954187 missense possibly damaging 0.76
IGL03405:Wnk1 APN 6 119953895 missense probably benign 0.41
Narrow UTSW 6 119992408 missense probably damaging 1.00
nictitate UTSW 6 120002280 missense possibly damaging 0.88
opportunity UTSW 6 119951068 missense probably damaging 1.00
path UTSW 6 120037149 missense probably damaging 0.99
Unforgiving UTSW 6 119948282 missense probably damaging 1.00
Window UTSW 6 119992453 missense probably damaging 1.00
woke UTSW 6 119962955 missense probably benign 0.12
IGL03052:Wnk1 UTSW 6 119944799 splice site probably benign
PIT4480001:Wnk1 UTSW 6 119963367 nonsense probably null
R0044:Wnk1 UTSW 6 120037149 missense probably damaging 0.99
R0333:Wnk1 UTSW 6 119928163 intron probably benign
R0453:Wnk1 UTSW 6 119963151 missense probably damaging 0.99
R0457:Wnk1 UTSW 6 119969332 missense probably damaging 1.00
R0501:Wnk1 UTSW 6 119962803 missense probably damaging 1.00
R0525:Wnk1 UTSW 6 119926564 missense probably damaging 1.00
R0526:Wnk1 UTSW 6 119951992 missense probably damaging 0.99
R0606:Wnk1 UTSW 6 119926683 missense probably damaging 1.00
R0658:Wnk1 UTSW 6 119948505 missense probably damaging 0.98
R1148:Wnk1 UTSW 6 119952006 splice site probably benign
R1188:Wnk1 UTSW 6 119948709 nonsense probably null
R1245:Wnk1 UTSW 6 119948457 missense probably benign 0.26
R1449:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R1469:Wnk1 UTSW 6 119950684 splice site probably benign
R1869:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1871:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1928:Wnk1 UTSW 6 119952923 missense probably damaging 1.00
R1959:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1961:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1964:Wnk1 UTSW 6 119934382 missense possibly damaging 0.86
R1983:Wnk1 UTSW 6 119937578 missense probably damaging 1.00
R2062:Wnk1 UTSW 6 119928157 splice site probably null
R2144:Wnk1 UTSW 6 119948988 unclassified probably benign
R2186:Wnk1 UTSW 6 119948567 missense probably benign 0.26
R2281:Wnk1 UTSW 6 119963640 splice site probably null
R2338:Wnk1 UTSW 6 119969534 missense probably benign 0.42
R2420:Wnk1 UTSW 6 119936367 critical splice donor site probably null
R3727:Wnk1 UTSW 6 119992453 missense probably damaging 1.00
R3773:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R3836:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3837:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3847:Wnk1 UTSW 6 119969354 missense possibly damaging 0.70
R3903:Wnk1 UTSW 6 119949051 missense probably damaging 1.00
R4031:Wnk1 UTSW 6 119951068 missense probably damaging 1.00
R4095:Wnk1 UTSW 6 119948126 missense probably damaging 1.00
R4232:Wnk1 UTSW 6 119949261 missense possibly damaging 0.90
R4422:Wnk1 UTSW 6 119953895 missense probably benign 0.41
R4423:Wnk1 UTSW 6 119926426 missense probably damaging 1.00
R4572:Wnk1 UTSW 6 119951911 missense possibly damaging 0.49
R4704:Wnk1 UTSW 6 119965744 missense possibly damaging 0.83
R4755:Wnk1 UTSW 6 119963470 missense probably damaging 0.98
R4812:Wnk1 UTSW 6 119952771 missense probably benign 0.16
R4822:Wnk1 UTSW 6 119962438 missense probably benign 0.02
R4879:Wnk1 UTSW 6 119949377 missense probably damaging 1.00
R4970:Wnk1 UTSW 6 119965735 intron probably benign
R5002:Wnk1 UTSW 6 119937963 missense probably benign 0.13
R5037:Wnk1 UTSW 6 119965735 intron probably benign
R5152:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R5257:Wnk1 UTSW 6 120037188 missense probably benign 0.00
R5354:Wnk1 UTSW 6 119968523 missense probably benign 0.01
R5421:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R5564:Wnk1 UTSW 6 119948891 unclassified probably benign
R5600:Wnk1 UTSW 6 119949358 missense probably damaging 1.00
R5847:Wnk1 UTSW 6 119992408 missense probably damaging 1.00
R6083:Wnk1 UTSW 6 120037601 missense probably damaging 0.99
R6110:Wnk1 UTSW 6 119972997 intron probably benign
R6128:Wnk1 UTSW 6 119963786 unclassified probably null
R6237:Wnk1 UTSW 6 119952767 missense probably damaging 1.00
R6341:Wnk1 UTSW 6 119948585 missense probably damaging 1.00
R6467:Wnk1 UTSW 6 119962955 missense probably benign 0.12
R6696:Wnk1 UTSW 6 119948282 missense probably damaging 1.00
R6888:Wnk1 UTSW 6 119948781 missense probably benign 0.26
R6923:Wnk1 UTSW 6 119965678 intron probably benign
R7024:Wnk1 UTSW 6 119965726 intron probably benign
R7072:Wnk1 UTSW 6 119937861 missense unknown
R7087:Wnk1 UTSW 6 120037530 missense possibly damaging 0.94
R7102:Wnk1 UTSW 6 119948307 missense unknown
R7134:Wnk1 UTSW 6 119926428 missense unknown
R7137:Wnk1 UTSW 6 120038212 unclassified probably benign
R7142:Wnk1 UTSW 6 119949279 missense probably benign 0.09
R7174:Wnk1 UTSW 6 119970978 missense probably damaging 1.00
R7205:Wnk1 UTSW 6 119943878 splice site probably null
R7218:Wnk1 UTSW 6 120002273 nonsense probably null
X0064:Wnk1 UTSW 6 120037032 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCCCAACAGAACAGCCAGTGG -3'
(R):5'- AATATTGCTCCCTCTTCCAACGTGG -3'

Sequencing Primer
(F):5'- GGCATTTCATTCTGCTGTAAGAC -3'
(R):5'- AACGTGGCTTCTGTTTGCATC -3'
Posted On2013-05-09