Mutagenetix > Incidental Mutation

Incidental Mutation 'R4549:Kcnd3'

333888

Institutional Source

Beutler Lab

Gene Symbol

Kcnd3

Ensembl Gene

ENSMUSG00000040896

Gene Name

potassium voltage-gated channel, Shal-related family, member 3

Synonyms

Kv4.3, potassium channel Kv4.3L, potassium channel Kv4.3M

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4549 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105359646-105581318 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105566082 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 421 (A421V)

Ref Sequence

ENSEMBL: ENSMUSP00000113436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]

AlphaFold

Q9Z0V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000079169
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: A421V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098761
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: A421V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	7.3e-19	PFAM
BTB	40	139	1.76e-16	SMART
transmembrane domain	180	202	N/A	INTRINSIC
Pfam:Ion_trans	228	402	1e-31	PFAM
Pfam:Ion_trans_2	327	408	8.4e-15	PFAM
low complexity region	412	431	N/A	INTRINSIC
Pfam:DUF3399	442	545	9.5e-52	PFAM
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118360
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: A421V

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	3.2e-17	PFAM
BTB	40	139	1.76e-16	SMART
Pfam:Ion_trans	182	414	6.6e-45	PFAM
Pfam:Ion_trans_2	327	408	9.5e-15	PFAM
Pfam:DUF3399	442	563	4.7e-46	PFAM
low complexity region	610	625	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141694

Meta Mutation Damage Score

0.1470

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	G	A	9: 59,217,511 (GRCm39)	V175I	probably damaging	Het
Aldh7a1	A	G	18: 56,665,066 (GRCm39)	V371A	probably benign	Het
Ankrd60	T	A	2: 173,414,395 (GRCm39)	T125S	possibly damaging	Het
Ap1m1	T	A	8: 72,994,064 (GRCm39)	Y7N	probably damaging	Het
Carmil3	G	A	14: 55,743,121 (GRCm39)		probably null	Het
Fsip2	T	A	2: 82,819,972 (GRCm39)	L5235H	probably damaging	Het
Galnt17	A	G	5: 131,179,775 (GRCm39)	L124P	probably damaging	Het
Gnpda2	T	A	5: 69,743,872 (GRCm39)	E54D	probably benign	Het
Ly6f	T	A	15: 75,143,579 (GRCm39)	N95K	probably benign	Het
Macf1	T	C	4: 123,367,486 (GRCm39)	D2425G	possibly damaging	Het
Prkdc	G	A	16: 15,554,734 (GRCm39)	E2152K	possibly damaging	Het
Serpinb6e	T	A	13: 34,017,214 (GRCm39)	T269S	possibly damaging	Het
Smg1	A	G	7: 117,758,906 (GRCm39)		probably benign	Het
Snapc1	C	A	12: 74,017,053 (GRCm39)	D9E	probably damaging	Het
Syt8	G	T	7: 141,993,199 (GRCm39)	V35L	probably benign	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Trappc10	T	C	10: 78,067,292 (GRCm39)	R49G	probably damaging	Het
Vmn1r81	A	T	7: 11,993,749 (GRCm39)	F286L	probably damaging	Het
Vwa5a	A	T	9: 38,649,221 (GRCm39)	K656N	probably benign	Het
Zfp438	A	G	18: 5,214,073 (GRCm39)	V295A	probably benign	Het

Other mutations in Kcnd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02296:Kcnd3	APN	3	105,574,317 (GRCm39)	nonsense	probably null
PIT4498001:Kcnd3	UTSW	3	105,566,025 (GRCm39)	missense	probably damaging	0.99
R0483:Kcnd3	UTSW	3	105,366,942 (GRCm39)	missense	probably damaging	1.00
R0544:Kcnd3	UTSW	3	105,566,075 (GRCm39)	missense	probably damaging	1.00
R1457:Kcnd3	UTSW	3	105,575,502 (GRCm39)	missense	probably benign	0.00
R1853:Kcnd3	UTSW	3	105,367,068 (GRCm39)	missense	probably damaging	1.00
R2030:Kcnd3	UTSW	3	105,366,853 (GRCm39)	missense	probably damaging	1.00
R2077:Kcnd3	UTSW	3	105,574,315 (GRCm39)	missense	probably benign	0.16
R2106:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2287:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2288:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2316:Kcnd3	UTSW	3	105,576,442 (GRCm39)	missense	probably benign	0.17
R2909:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2924:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R2925:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3014:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3016:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3038:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3696:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3697:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3698:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3777:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3778:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3785:Kcnd3	UTSW	3	105,575,541 (GRCm39)	missense	possibly damaging	0.79
R3810:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3811:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3815:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3816:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3819:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3877:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3879:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R3899:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4300:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4367:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4370:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4491:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4550:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4569:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4571:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4593:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4594:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4595:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4624:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4625:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4627:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4630:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4631:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4632:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4799:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R4822:Kcnd3	UTSW	3	105,566,082 (GRCm39)	missense	probably damaging	1.00
R5021:Kcnd3	UTSW	3	105,566,070 (GRCm39)	missense	probably damaging	1.00
R5056:Kcnd3	UTSW	3	105,574,244 (GRCm39)	intron	probably benign
R5849:Kcnd3	UTSW	3	105,366,111 (GRCm39)	utr 5 prime	probably benign
R7198:Kcnd3	UTSW	3	105,366,856 (GRCm39)	missense	probably damaging	1.00
R7224:Kcnd3	UTSW	3	105,576,400 (GRCm39)	missense	probably damaging	0.98
R7532:Kcnd3	UTSW	3	105,575,526 (GRCm39)	missense	probably damaging	1.00
R7578:Kcnd3	UTSW	3	105,366,933 (GRCm39)	missense	probably benign	0.08
R7975:Kcnd3	UTSW	3	105,366,310 (GRCm39)	missense	probably damaging	1.00
R8022:Kcnd3	UTSW	3	105,366,189 (GRCm39)	missense	probably benign	0.19
R8823:Kcnd3	UTSW	3	105,574,330 (GRCm39)	missense	probably benign	0.00
R8986:Kcnd3	UTSW	3	105,367,039 (GRCm39)	missense	probably damaging	1.00
R9056:Kcnd3	UTSW	3	105,574,290 (GRCm39)	missense	possibly damaging	0.48
R9345:Kcnd3	UTSW	3	105,566,003 (GRCm39)	missense	probably damaging	1.00
R9513:Kcnd3	UTSW	3	105,572,863 (GRCm39)	critical splice donor site	probably null
Z1177:Kcnd3	UTSW	3	105,366,886 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ATGAAGCCCCACTTGTTTCC -3'
(R):5'- CTAACTGAGGACATTGGTGGG -3'

Sequencing Primer
(F):5'- ACTTGTTTCCCACATGGCC -3'
(R):5'- GTAGGAGGATACAACACCGCC -3'

Posted On

2015-08-18