Incidental Mutation 'R4549:Ap1m1'
ID 333896
Institutional Source Beutler Lab
Gene Symbol Ap1m1
Ensembl Gene ENSMUSG00000003033
Gene Name adaptor-related protein complex AP-1, mu subunit 1
Synonyms mu1A, Cltnm, Adtm1A, AP47, [m]1A
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4549 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 72993862-73011229 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72994064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 7 (Y7N)
Ref Sequence ENSEMBL: ENSMUSP00000148530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003117] [ENSMUST00000126885] [ENSMUST00000145213] [ENSMUST00000212708] [ENSMUST00000212841] [ENSMUST00000212940]
AlphaFold P35585
Predicted Effect possibly damaging
Transcript: ENSMUST00000003117
AA Change: Y7N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003117
Gene: ENSMUSG00000003033
AA Change: Y7N

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 4.6e-7 PFAM
Pfam:Adap_comp_sub 157 422 2.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126885
SMART Domains Protein: ENSMUSP00000120435
Gene: ENSMUSG00000003033

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 4 115 4.8e-7 PFAM
Pfam:Adap_comp_sub 131 181 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145213
SMART Domains Protein: ENSMUSP00000138319
Gene: ENSMUSG00000003033

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 3 107 7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000212708
AA Change: Y7N
Predicted Effect probably damaging
Transcript: ENSMUST00000212841
AA Change: Y7N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000212940
AA Change: Y7N
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu-1 subunit of the scaffolding adapter protein complex AP-1 and is a member of the mu adaptin family. The AP-1 complex, which consists of 4 subunits (mu-adaptin, beta-prime adaptin, gamma-adaptin, and the small chain adaptin), is one of the predominant coat proteins of membrane vesicles involved in eukaryotic post-Golgi trafficking. The AP-1 complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. AP-1 complex subunit mu-1 and other mu-adaptins select cargo proteins bearing sequence-specific sorting motifs. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E13.5. Homozygous embryos display hemorrhage of the ventricles and spinal canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk G A 9: 59,217,511 (GRCm39) V175I probably damaging Het
Aldh7a1 A G 18: 56,665,066 (GRCm39) V371A probably benign Het
Ankrd60 T A 2: 173,414,395 (GRCm39) T125S possibly damaging Het
Carmil3 G A 14: 55,743,121 (GRCm39) probably null Het
Fsip2 T A 2: 82,819,972 (GRCm39) L5235H probably damaging Het
Galnt17 A G 5: 131,179,775 (GRCm39) L124P probably damaging Het
Gnpda2 T A 5: 69,743,872 (GRCm39) E54D probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Ly6f T A 15: 75,143,579 (GRCm39) N95K probably benign Het
Macf1 T C 4: 123,367,486 (GRCm39) D2425G possibly damaging Het
Prkdc G A 16: 15,554,734 (GRCm39) E2152K possibly damaging Het
Serpinb6e T A 13: 34,017,214 (GRCm39) T269S possibly damaging Het
Smg1 A G 7: 117,758,906 (GRCm39) probably benign Het
Snapc1 C A 12: 74,017,053 (GRCm39) D9E probably damaging Het
Syt8 G T 7: 141,993,199 (GRCm39) V35L probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trappc10 T C 10: 78,067,292 (GRCm39) R49G probably damaging Het
Vmn1r81 A T 7: 11,993,749 (GRCm39) F286L probably damaging Het
Vwa5a A T 9: 38,649,221 (GRCm39) K656N probably benign Het
Zfp438 A G 18: 5,214,073 (GRCm39) V295A probably benign Het
Other mutations in Ap1m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ap1m1 APN 8 73,009,599 (GRCm39) missense possibly damaging 0.53
IGL00795:Ap1m1 APN 8 73,007,353 (GRCm39) missense probably damaging 1.00
IGL02165:Ap1m1 APN 8 73,003,653 (GRCm39) missense probably benign 0.41
R0363:Ap1m1 UTSW 8 73,010,568 (GRCm39) unclassified probably benign
R0363:Ap1m1 UTSW 8 73,006,738 (GRCm39) missense probably benign 0.22
R1295:Ap1m1 UTSW 8 73,005,719 (GRCm39) splice site probably null
R1681:Ap1m1 UTSW 8 73,009,966 (GRCm39) missense possibly damaging 0.95
R1784:Ap1m1 UTSW 8 73,006,693 (GRCm39) missense probably benign 0.01
R1934:Ap1m1 UTSW 8 73,009,637 (GRCm39) missense probably damaging 1.00
R4654:Ap1m1 UTSW 8 73,006,717 (GRCm39) missense possibly damaging 0.94
R6003:Ap1m1 UTSW 8 73,003,011 (GRCm39) missense probably damaging 1.00
R7048:Ap1m1 UTSW 8 73,003,642 (GRCm39) missense probably damaging 1.00
R8253:Ap1m1 UTSW 8 73,006,730 (GRCm39) missense probably damaging 1.00
R9112:Ap1m1 UTSW 8 72,994,066 (GRCm39) nonsense probably null
R9134:Ap1m1 UTSW 8 72,993,913 (GRCm39) unclassified probably benign
R9641:Ap1m1 UTSW 8 73,003,606 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTCAGACCGGACATAACG -3'
(R):5'- CCAAGTTGGCTAGCAATGGG -3'

Sequencing Primer
(F):5'- GGTCCACGCGCTGCTTC -3'
(R):5'- CCCATTTCCTAGTAACTTGGTAGGG -3'
Posted On 2015-08-18