Incidental Mutation 'R4551:Micalcl'
ID333957
Institutional Source Beutler Lab
Gene Symbol Micalcl
Ensembl Gene ENSMUSG00000030771
Gene NameMICAL C-terminal like
SynonymsEbitein1, 4921517J23Rik
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location112368308-112413106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112381916 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 366 (S366T)
Ref Sequence ENSEMBL: ENSMUSP00000102256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033033] [ENSMUST00000051308] [ENSMUST00000106645]
Predicted Effect probably benign
Transcript: ENSMUST00000033033
AA Change: S432T

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033033
Gene: ENSMUSG00000030771
AA Change: S432T

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 72 100 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 545 562 N/A INTRINSIC
coiled coil region 569 597 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000051308
AA Change: S366T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062443
Gene: ENSMUSG00000030771
AA Change: S366T

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106645
AA Change: S366T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102256
Gene: ENSMUSG00000030771
AA Change: S366T

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000213108
AA Change: S256T
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect unknown
Transcript: ENSMUST00000216652
AA Change: S578T
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Micalcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Micalcl APN 7 112382145 missense possibly damaging 0.94
IGL01775:Micalcl APN 7 112382062 missense possibly damaging 0.89
IGL02051:Micalcl APN 7 112381390 missense probably benign 0.30
IGL03114:Micalcl APN 7 112397557 missense probably damaging 1.00
R0091:Micalcl UTSW 7 112381296 missense probably benign 0.05
R0415:Micalcl UTSW 7 112381028 missense probably damaging 1.00
R0962:Micalcl UTSW 7 112380417 missense probably damaging 0.99
R1521:Micalcl UTSW 7 112381610 missense probably damaging 1.00
R1611:Micalcl UTSW 7 112381464 missense probably damaging 0.99
R1815:Micalcl UTSW 7 112412902 missense probably damaging 1.00
R1958:Micalcl UTSW 7 112381104 missense probably benign 0.00
R1962:Micalcl UTSW 7 112412844 missense probably benign 0.14
R2439:Micalcl UTSW 7 112394795 missense probably damaging 0.99
R3979:Micalcl UTSW 7 112407678 intron probably null
R4583:Micalcl UTSW 7 112412947 missense probably benign 0.02
R5459:Micalcl UTSW 7 112382237 missense probably benign 0.00
R5763:Micalcl UTSW 7 112374654 critical splice donor site probably null
R6042:Micalcl UTSW 7 112380412 missense probably benign 0.40
R6189:Micalcl UTSW 7 112412880 missense probably damaging 1.00
R6750:Micalcl UTSW 7 112381839 missense probably damaging 0.98
R6798:Micalcl UTSW 7 112376059 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGAGTCCAAAACTTTGC -3'
(R):5'- TGTTTGCATTCCTGGAGAAAACTC -3'

Sequencing Primer
(F):5'- TCCAAAACTTTGCCTAGGGG -3'
(R):5'- TTCCTGGAGAAAACTCTCAAAGG -3'
Posted On2015-08-18