Incidental Mutation 'R4551:Aatk'
ID333971
Institutional Source Beutler Lab
Gene Symbol Aatk
Ensembl Gene ENSMUSG00000025375
Gene Nameapoptosis-associated tyrosine kinase
SynonymsAATYK1
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120007313-120047167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120011569 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 610 (E610A)
Ref Sequence ENSEMBL: ENSMUSP00000099309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020] [ENSMUST00000106233]
Predicted Effect probably benign
Transcript: ENSMUST00000026436
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064307
AA Change: E667A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: E667A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 49 N/A INTRINSIC
Pfam:Pkinase_Tyr 135 405 3.9e-63 PFAM
Pfam:Pkinase 136 404 2.6e-33 PFAM
low complexity region 425 457 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 615 624 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
low complexity region 808 819 N/A INTRINSIC
low complexity region 913 927 N/A INTRINSIC
low complexity region 934 943 N/A INTRINSIC
low complexity region 985 1004 N/A INTRINSIC
low complexity region 1063 1082 N/A INTRINSIC
low complexity region 1085 1096 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
low complexity region 1179 1204 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083666
Predicted Effect probably benign
Transcript: ENSMUST00000103019
AA Change: E610A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: E610A

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103020
AA Change: E610A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: E610A

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106233
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198674
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Aatk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Aatk APN 11 120010186 missense probably benign 0.02
IGL00953:Aatk APN 11 120011221 missense probably benign 0.00
IGL01019:Aatk APN 11 120012275 missense probably benign
IGL01758:Aatk APN 11 120010819 missense possibly damaging 0.86
IGL02377:Aatk APN 11 120046863 utr 5 prime probably benign
IGL02902:Aatk APN 11 120011777 missense probably benign 0.00
IGL03067:Aatk APN 11 120010083 missense probably benign 0.00
IGL03116:Aatk APN 11 120016751 missense probably benign 0.14
IGL03279:Aatk APN 11 120013678 missense probably damaging 1.00
IGL03405:Aatk APN 11 120016403 missense probably benign 0.02
PIT4366001:Aatk UTSW 11 120010960 missense possibly damaging 0.55
PIT4802001:Aatk UTSW 11 120011346 missense probably benign
R0101:Aatk UTSW 11 120010913 missense probably benign 0.19
R0497:Aatk UTSW 11 120018780 missense probably damaging 0.99
R0535:Aatk UTSW 11 120010193 missense probably benign 0.00
R0638:Aatk UTSW 11 120009922 missense probably damaging 1.00
R0939:Aatk UTSW 11 120012143 missense probably damaging 0.99
R1475:Aatk UTSW 11 120010888 missense probably damaging 0.96
R1840:Aatk UTSW 11 120013732 missense probably damaging 1.00
R1865:Aatk UTSW 11 120010222 missense probably benign 0.00
R1982:Aatk UTSW 11 120013514 missense probably damaging 1.00
R2027:Aatk UTSW 11 120009317 missense probably damaging 1.00
R2115:Aatk UTSW 11 120009736 missense probably benign
R2220:Aatk UTSW 11 120012177 missense probably damaging 1.00
R2264:Aatk UTSW 11 120010274 missense probably damaging 1.00
R2504:Aatk UTSW 11 120018855 missense probably benign 0.00
R3872:Aatk UTSW 11 120010219 missense possibly damaging 0.71
R4657:Aatk UTSW 11 120013478 missense possibly damaging 0.69
R4744:Aatk UTSW 11 120016122 missense possibly damaging 0.64
R4924:Aatk UTSW 11 120011525 missense probably damaging 1.00
R5063:Aatk UTSW 11 120010489 missense probably benign 0.07
R5223:Aatk UTSW 11 120013452 missense possibly damaging 0.95
R5243:Aatk UTSW 11 120016768 missense probably damaging 1.00
R5376:Aatk UTSW 11 120012034 missense probably damaging 0.98
R5442:Aatk UTSW 11 120018768 missense probably benign 0.02
R5550:Aatk UTSW 11 120009303 missense probably benign 0.42
R5678:Aatk UTSW 11 120010154 missense probably benign 0.00
R5932:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6026:Aatk UTSW 11 120012364 missense possibly damaging 0.65
R6129:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6409:Aatk UTSW 11 120011732 missense probably benign 0.01
R6477:Aatk UTSW 11 120018870 missense probably benign 0.00
R6478:Aatk UTSW 11 120010991 missense probably benign 0.00
R6749:Aatk UTSW 11 120010774 missense possibly damaging 0.58
R6753:Aatk UTSW 11 120010151 missense probably benign
R6787:Aatk UTSW 11 120010682 missense probably damaging 1.00
R6852:Aatk UTSW 11 120010468 missense probably benign 0.10
R7114:Aatk UTSW 11 120009619 missense probably benign
R7557:Aatk UTSW 11 120009430 missense possibly damaging 0.73
X0064:Aatk UTSW 11 120011176 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AATCTCTGGGATCCTCCTGG -3'
(R):5'- TCACATAGGAGGCAAGGGTC -3'

Sequencing Primer
(F):5'- AGGAGATGGCCCACCTCAG -3'
(R):5'- GGGTCACCCTGTCCCTCAC -3'
Posted On2015-08-18