Incidental Mutation 'R4552:Klk4'
ID334010
Institutional Source Beutler Lab
Gene Symbol Klk4
Ensembl Gene ENSMUSG00000006948
Gene Namekallikrein related-peptidase 4 (prostase, enamel matrix, prostate)
SynonymsESMP1, Prss17, KLK-L1
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43881160-43885804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43884019 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 101 (H101N)
Ref Sequence ENSEMBL: ENSMUSP00000007161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007161]
Predicted Effect probably benign
Transcript: ENSMUST00000007161
AA Change: H101N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007161
Gene: ENSMUSG00000006948
AA Change: H101N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Tryp_SPc 31 248 2.42e-82 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Several transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced enamel strength that leads to enamel fracturing, delayed postnatal growth, and decreased survival to maturity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Klk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Klk4 UTSW 7 43885361 missense probably damaging 1.00
R0385:Klk4 UTSW 7 43884008 missense probably benign 0.02
R1381:Klk4 UTSW 7 43885282 missense probably damaging 1.00
R4329:Klk4 UTSW 7 43884406 missense probably damaging 1.00
R4600:Klk4 UTSW 7 43885338 missense probably damaging 1.00
R6023:Klk4 UTSW 7 43884058 missense probably benign 0.00
R7164:Klk4 UTSW 7 43881698 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAAGTGGCCACAGTGTTGAG -3'
(R):5'- CAGCAGCTTACCATTCTTTAGTTG -3'

Sequencing Primer
(F):5'- CCTAAGGGACAGGGCAGTC -3'
(R):5'- GTTGACCCCAACCAGAGACTAGG -3'
Posted On2015-08-18