Incidental Mutation 'R4518:Farp2'
ID334042
Institutional Source Beutler Lab
Gene Symbol Farp2
Ensembl Gene ENSMUSG00000034066
Gene NameFERM, RhoGEF and pleckstrin domain protein 2
SynonymsFir, D030026M03Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93512079-93621976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93620641 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1016 (E1016G)
Ref Sequence ENSEMBL: ENSMUSP00000112725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000120301]
PDB Structure
Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000120301
AA Change: E1016G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066
AA Change: E1016G

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154008
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit slight increase in bone volumetrics and reduced osteoclast differentiation from BMDMs cultured with M-CSF and RANKL [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Farp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Farp2 APN 1 93603381 missense probably benign 0.00
IGL00953:Farp2 APN 1 93561174 missense possibly damaging 0.92
IGL00961:Farp2 APN 1 93621313 missense possibly damaging 0.81
IGL00970:Farp2 APN 1 93560327 missense probably benign 0.00
IGL01377:Farp2 APN 1 93603459 missense possibly damaging 0.74
IGL01408:Farp2 APN 1 93618980 missense probably benign 0.19
IGL01919:Farp2 APN 1 93576433 missense probably damaging 1.00
IGL01985:Farp2 APN 1 93607602 missense probably damaging 1.00
IGL02375:Farp2 APN 1 93576463 missense probably damaging 1.00
IGL02392:Farp2 APN 1 93577650 missense probably damaging 1.00
IGL02815:Farp2 APN 1 93560285 missense probably damaging 1.00
IGL03003:Farp2 APN 1 93567418 missense probably damaging 1.00
IGL03074:Farp2 APN 1 93560327 missense probably benign 0.00
IGL03223:Farp2 APN 1 93617602 nonsense probably null
IGL03379:Farp2 APN 1 93607438 missense probably benign 0.08
IGL02802:Farp2 UTSW 1 93528610 missense probably damaging 1.00
PIT4468001:Farp2 UTSW 1 93528777 nonsense probably null
PIT4494001:Farp2 UTSW 1 93617594 missense probably damaging 1.00
R0207:Farp2 UTSW 1 93569087 missense probably damaging 0.96
R0521:Farp2 UTSW 1 93576821 critical splice acceptor site probably null
R0594:Farp2 UTSW 1 93576500 missense probably damaging 1.00
R1386:Farp2 UTSW 1 93620151 splice site probably null
R1522:Farp2 UTSW 1 93618553 missense possibly damaging 0.79
R1589:Farp2 UTSW 1 93579860 missense probably damaging 1.00
R1651:Farp2 UTSW 1 93603469 critical splice donor site probably null
R1695:Farp2 UTSW 1 93560325 missense probably damaging 0.97
R1833:Farp2 UTSW 1 93576364 splice site probably benign
R1915:Farp2 UTSW 1 93528702 missense probably benign 0.16
R2241:Farp2 UTSW 1 93579903 missense probably benign 0.31
R4505:Farp2 UTSW 1 93619010 missense probably damaging 1.00
R4551:Farp2 UTSW 1 93618592 missense possibly damaging 0.92
R4723:Farp2 UTSW 1 93580899 missense probably benign 0.07
R4821:Farp2 UTSW 1 93574470 splice site probably null
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R5221:Farp2 UTSW 1 93576418 missense probably damaging 0.99
R5625:Farp2 UTSW 1 93528748 missense probably damaging 1.00
R5663:Farp2 UTSW 1 93570013 missense probably damaging 1.00
R5935:Farp2 UTSW 1 93620645 critical splice donor site probably null
R6593:Farp2 UTSW 1 93569940 missense possibly damaging 0.48
R6853:Farp2 UTSW 1 93570016 missense probably damaging 1.00
R7001:Farp2 UTSW 1 93620184 missense possibly damaging 0.94
R7001:Farp2 UTSW 1 93620230 missense possibly damaging 0.94
R7133:Farp2 UTSW 1 93621234 missense probably damaging 1.00
R7134:Farp2 UTSW 1 93603459 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACTTTCTTGGGAGAGTCAGTG -3'
(R):5'- GCTCCAGAAGTCCTTTGGTC -3'

Sequencing Primer
(F):5'- TGTGTAGGACTCCTGGCC -3'
(R):5'- GGTCATTGTATGTATGCACACATG -3'
Posted On2015-08-18