Incidental Mutation 'R4518:Orc4'
ID334051
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48937489 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 31 (P31S)
Ref Sequence ENSEMBL: ENSMUSP00000088497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000123271] [ENSMUST00000142851] [ENSMUST00000149679]
Predicted Effect probably benign
Transcript: ENSMUST00000028098
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090976
AA Change: P31S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
Pfam:AAA_16 34 138 3.3e-14 PFAM
Pfam:KAP_NTPase 38 123 2.9e-7 PFAM
Pfam:Arch_ATPase 43 130 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123271
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect probably benign
Transcript: ENSMUST00000142851
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149679
AA Change: P31S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121114
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
SCOP:d1jbka_ 43 73 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCTACCAGGTGTTAAGTACCAG -3'
(R):5'- GTTCTGCCATTCACTGACGTG -3'

Sequencing Primer
(F):5'- CTACCAGGTGTTAAGTACCAGAATTC -3'
(R):5'- GACGTGACATCTCATTATTTACCTG -3'
Posted On2015-08-18