Incidental Mutation 'R4518:Tlr6'
ID334064
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64954904 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 220 (F220S)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062315
AA Change: F220S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: F220S

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGCACTTCCAGGTTGTTTC -3'
(R):5'- TTCAATGACTTTGATGTACTGCCTG -3'

Sequencing Primer
(F):5'- CTATGTGCTGGAGGGTCACATTC -3'
(R):5'- TTTGGCAACCTGACGAAGCTG -3'
Posted On2015-08-18