Incidental Mutation 'R4518:Atp8b3'
ID334080
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80523847 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 984 (M984I)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: M984I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: M984I

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGCTAGATATGGCCACCAATAC -3'
(R):5'- TTGGATCATGGGACTGGGAAC -3'

Sequencing Primer
(F):5'- TACCCCTAAGGACTGGTAGTC -3'
(R):5'- GGCAGCTTCATCTCACATCTAAG -3'
Posted On2015-08-18