Incidental Mutation 'R4518:Ccdc88a'
ID334082
Institutional Source Beutler Lab
Gene Symbol Ccdc88a
Ensembl Gene ENSMUSG00000032740
Gene Namecoiled coil domain containing 88A
SynonymsGirdin, GIV, A430106J12Rik, D130005J21Rik, HkRP1, C130096N06Rik, C330012F17Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29373658-29510808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29482651 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1219 (I1219T)
Ref Sequence ENSEMBL: ENSMUSP00000048978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040182] [ENSMUST00000140194] [ENSMUST00000155854]
Predicted Effect probably benign
Transcript: ENSMUST00000040182
AA Change: I1219T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740
AA Change: I1219T

DomainStartEndE-ValueType
Pfam:HOOK 14 590 8.1e-36 PFAM
low complexity region 614 625 N/A INTRINSIC
Blast:BRLZ 665 719 6e-22 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
low complexity region 955 985 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1268 1385 N/A INTRINSIC
low complexity region 1437 1444 N/A INTRINSIC
low complexity region 1566 1576 N/A INTRINSIC
internal_repeat_1 1609 1702 2.38e-6 PROSPERO
internal_repeat_1 1708 1808 2.38e-6 PROSPERO
low complexity region 1811 1824 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123561
AA Change: I199T
SMART Domains Protein: ENSMUSP00000119173
Gene: ENSMUSG00000032740
AA Change: I199T

DomainStartEndE-ValueType
coiled coil region 1 212 N/A INTRINSIC
coiled coil region 248 365 N/A INTRINSIC
low complexity region 418 425 N/A INTRINSIC
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140194
SMART Domains Protein: ENSMUSP00000114942
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
coiled coil region 3 85 N/A INTRINSIC
low complexity region 137 144 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155854
SMART Domains Protein: ENSMUSP00000115117
Gene: ENSMUSG00000032740

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 146 176 N/A INTRINSIC
Blast:BRLZ 228 283 7e-6 BLAST
low complexity region 284 295 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Ccdc88a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Ccdc88a APN 11 29499341 missense probably benign 0.24
IGL00577:Ccdc88a APN 11 29424772 missense probably damaging 1.00
IGL00766:Ccdc88a APN 11 29501046 missense probably damaging 0.99
IGL01384:Ccdc88a APN 11 29503915 missense probably damaging 0.99
IGL01541:Ccdc88a APN 11 29400283 missense probably benign
IGL01647:Ccdc88a APN 11 29504321 unclassified probably benign
IGL02648:Ccdc88a APN 11 29501051 missense probably benign 0.28
IGL02885:Ccdc88a APN 11 29448050 missense probably damaging 1.00
IGL03117:Ccdc88a APN 11 29374559 missense probably damaging 1.00
IGL03196:Ccdc88a APN 11 29482340 missense possibly damaging 0.56
trailor UTSW 11 29494099 splice site probably null
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0083:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0108:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0326:Ccdc88a UTSW 11 29461021 missense probably benign 0.01
R0565:Ccdc88a UTSW 11 29461042 unclassified probably benign
R0631:Ccdc88a UTSW 11 29493752 missense probably damaging 0.98
R0632:Ccdc88a UTSW 11 29482749 unclassified probably benign
R0762:Ccdc88a UTSW 11 29463112 unclassified probably benign
R0838:Ccdc88a UTSW 11 29400285 missense probably damaging 1.00
R0946:Ccdc88a UTSW 11 29456509 missense probably benign
R1192:Ccdc88a UTSW 11 29504049 missense possibly damaging 0.45
R1500:Ccdc88a UTSW 11 29482713 missense probably benign 0.00
R1701:Ccdc88a UTSW 11 29477427 missense possibly damaging 0.59
R1826:Ccdc88a UTSW 11 29489637 missense possibly damaging 0.58
R1902:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R1903:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R2021:Ccdc88a UTSW 11 29503480 missense probably damaging 1.00
R2023:Ccdc88a UTSW 11 29463546 nonsense probably null
R2284:Ccdc88a UTSW 11 29494099 splice site probably null
R3236:Ccdc88a UTSW 11 29447995 missense possibly damaging 0.51
R3409:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3410:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3411:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3430:Ccdc88a UTSW 11 29448033 missense probably damaging 0.98
R3620:Ccdc88a UTSW 11 29430227 missense probably benign 0.16
R4204:Ccdc88a UTSW 11 29463399 missense probably damaging 1.00
R4515:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4519:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4693:Ccdc88a UTSW 11 29482241 missense probably damaging 1.00
R4705:Ccdc88a UTSW 11 29422586 missense probably benign
R4707:Ccdc88a UTSW 11 29447956 missense probably benign
R4732:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4733:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4734:Ccdc88a UTSW 11 29482720 missense probably benign
R4749:Ccdc88a UTSW 11 29482720 missense probably benign
R4817:Ccdc88a UTSW 11 29460907 missense probably benign 0.15
R4828:Ccdc88a UTSW 11 29463210 missense probably damaging 1.00
R4979:Ccdc88a UTSW 11 29482133 nonsense probably null
R5288:Ccdc88a UTSW 11 29498416 missense possibly damaging 0.77
R5373:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5374:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5401:Ccdc88a UTSW 11 29463279 missense probably benign 0.00
R5586:Ccdc88a UTSW 11 29503484 missense probably benign 0.00
R6660:Ccdc88a UTSW 11 29482663 missense probably benign 0.01
R7116:Ccdc88a UTSW 11 29504051 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGACCTTGAAGACCGGTAAC -3'
(R):5'- CCTGGTAAGTCTAAATTGTGACTG -3'

Sequencing Primer
(F):5'- GACCTTGAAGACCGGTAACTTATC -3'
(R):5'- TGTGACTGCTATTAAACACACAC -3'
Posted On2015-08-18