Incidental Mutation 'R4518:Abr'
ID334083
Institutional Source Beutler Lab
Gene Symbol Abr
Ensembl Gene ENSMUSG00000017631
Gene Nameactive BCR-related gene
Synonyms6330400K15Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76416734-76622314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76472518 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 167 (S167P)
Ref Sequence ENSEMBL: ENSMUSP00000104045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408] [ENSMUST00000151526]
Predicted Effect probably benign
Transcript: ENSMUST00000065028
SMART Domains Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
Pfam:RhoGEF 12 65 5.4e-11 PFAM
PH 84 243 1.58e-11 SMART
C2 287 394 1.88e-11 SMART
RhoGAP 440 619 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072740
AA Change: S204P

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631
AA Change: S204P

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094012
AA Change: S216P

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: S216P

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108407
AA Change: S158P

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631
AA Change: S158P

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108408
AA Change: S167P

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631
AA Change: S167P

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
RhoGEF 58 246 2.37e-56 SMART
PH 265 424 1.58e-11 SMART
C2 468 575 1.88e-11 SMART
RhoGAP 621 800 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141442
Predicted Effect possibly damaging
Transcript: ENSMUST00000151526
AA Change: S114P

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135544
Gene: ENSMUSG00000017631
AA Change: S114P

DomainStartEndE-ValueType
RhoGEF 5 161 3.85e-24 SMART
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Abr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Abr APN 11 76423089 missense probably damaging 0.96
IGL00571:Abr APN 11 76468740 missense probably benign 0.45
IGL01774:Abr APN 11 76464299 splice site probably benign
IGL02208:Abr APN 11 76455645 missense probably damaging 1.00
IGL02477:Abr APN 11 76461360 missense probably damaging 1.00
IGL02499:Abr APN 11 76509090 missense probably benign 0.39
IGL02606:Abr APN 11 76479164 missense probably damaging 1.00
IGL02955:Abr APN 11 76419165 missense probably damaging 1.00
IGL03136:Abr APN 11 76425295 nonsense probably null
R0051:Abr UTSW 11 76472502 missense probably benign 0.02
R0311:Abr UTSW 11 76509127 missense possibly damaging 0.83
R0344:Abr UTSW 11 76479044 missense probably damaging 0.99
R0621:Abr UTSW 11 76509072 missense probably damaging 1.00
R0771:Abr UTSW 11 76455683 missense probably damaging 1.00
R1081:Abr UTSW 11 76455615 missense probably damaging 1.00
R1842:Abr UTSW 11 76508986 missense probably damaging 1.00
R2036:Abr UTSW 11 76452350 missense probably benign 0.08
R2147:Abr UTSW 11 76455648 missense probably damaging 1.00
R2250:Abr UTSW 11 76451939 missense probably damaging 1.00
R3153:Abr UTSW 11 76486469 missense probably damaging 1.00
R3928:Abr UTSW 11 76468735 missense probably benign 0.01
R4507:Abr UTSW 11 76451857 missense possibly damaging 0.65
R4632:Abr UTSW 11 76509019 missense probably benign 0.10
R4751:Abr UTSW 11 76456608 missense possibly damaging 0.79
R4853:Abr UTSW 11 76464261 missense probably damaging 1.00
R5255:Abr UTSW 11 76455683 missense probably damaging 1.00
R5693:Abr UTSW 11 76463577 missense probably damaging 1.00
R6459:Abr UTSW 11 76424989 missense probably damaging 0.98
R6478:Abr UTSW 11 76452332 missense probably damaging 0.99
R7030:Abr UTSW 11 76459212 missense probably damaging 1.00
R7221:Abr UTSW 11 76423161 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAAATGTCAGGCTGAGCATTATTG -3'
(R):5'- TTCCAGCAAACCCTTTGGAGC -3'

Sequencing Primer
(F):5'- ATTGTGGTGAACAGCTTCCC -3'
(R):5'- CAGCAAACCCTTTGGAGCTAAGTTAG -3'
Posted On2015-08-18